Why are bananas curved?

Answers

Answer 1

Answer:

It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.

Explanation:

g.o.o.g.l.e lma o

Answer 2

Answer

It's because of the sun!

Explanation:

Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.


Related Questions

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

The recessive gene for blood typing s...
Type O
Type A
Type B
Type AB

Answers

Answer:

Image result for what is The recessive gene for blood typing

Because A is dominant, that means your mother could carry a hidden O. If she does then when she gets pregnant, each child has a 50% chance of getting her dominant A and a 50% chance of getting her hidden, recessive O. If the child gets the O from mom and an O from dad, he or she will have an O blood type.

Explanation:

Brainliest if right?

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

A simple life cycle is one in which the offspring look similar to their parents.
True
Or
False

Answers

False — life cycles have to do with birth to death progressions, not genetic traits.

trna is bring a ggu anticodon what amino acid do you infer it will be carrying?

Answers

Proline

This is the amino acid that corresponds to GGU

if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died

Answers

Answer:

There are 1600 atoms when organism just died.

Explanation:

The statement is incorrect. The correct statement is:

If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?

The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:

[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)

Where:

[tex]n_{o}[/tex] - Initial amount of atoms.

[tex]n(t)[/tex] - Current amount of atoms.

[tex]t[/tex] - Time, measured in years.

[tex]\tau[/tex] - Time constant, measured in years.

In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:

[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)

If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:

[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]

[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]

[tex]\tau \approx 8,266.643\,yr[/tex]

[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]

[tex]n_{o} \approx 1600[/tex]

There are 1600 atoms when organism just died.

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

In mature animals when do cells still need to differentiate?

Answers

Answer:

As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.

Explanation:

''.''

In mature animals cells differentiate during : Repair and replacement of  animal cells

Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.

While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.

Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.

Learn more : https://brainly.com/question/19015367

A cell membrane is called _____________ because it allows only certain substances to enter and leave the cell *

a. exocytosis
b. endocytosis
c. semipermeable
d. diffusion

Answers

The answers is semi permeable hope this helps

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

it takes 25 min to cook 10 egg how long does it take to cook 20​

Answers

Answer:

it takes 50 min

Explanation:

20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.

Work for it:

10 x 2 = 20

10 eggs=10 min

25x2=50

Answer:

it takes 50 minutes to cook 20 eggs

Explanation:

ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50

hope this helps

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement

Answers

Answer:

paper bags jute bags , cotton bags might be used for the environment

Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?

Answers

Answer:

Abnormally high temperature

Explanation:

Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.

When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.

Gravitational force multiple choice

Answers

Answer:

Option B. The force would be quartered (factor of 1/4).

Explanation:

The gravitational force between two objects can be expressed with the equation:

By analyzing the equation, we can see that if we multiply both m1 and m2 by 1/2, the resulting new F would be lower by a factor of 1/4 (as 1/2 times 1/2 equals 1/4).

Thus the correct answer is option B.

4 points
The inferred temperature and pressure of Earth's
interior at a depth of 3,000 kilometers are
approximately
(1) 1000°C and 0.5 million atmospheres
(2) 1000°C and 1.0 million atmospheres
(3) 5000°C and 1.5 million atmospheres
(4) 5000°C and 3.0 million atmospheres

Answers

Answer:

(4) 5000°C and 3.0 million atmospheres

Explanation:

The inferred temperature is 5000°C and pressure of Earth's  interior is 3.0 million atmospheres at a depth of 3,000 kilometers. At the depth of 3000 kilometers, core of the earth is present which is very hot and it is mostly consist of iron. The inner core has a radius of about 1,220 kilometers while the outer core is about 1,400 miles thick which comprise of iron, Nickle, gold, platinum, and uranium elements.

Through which of the following
would a sound wave travel the fastest?
a. Water vapor in the air
b. Water in the glass
c. Surrounding air
d. The glass

Answers

Answer:

D. The glass.

Explanation:

Sound travels fastest through solids. This is because molecules in a solid medium are much closer together than those in a liquid or gas, allowing sound waves to travel more quickly through it.

Hope this helps :D

The correct answer is D. The Glass Explanation: since the atoms in solids are closer together they would transfer sound the best, because sound travels best through solids

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right

What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT

Answers

Answer: A U G U G G A A C C G C U G C U G A

Explanation:

Answer:

AUGUGGAACCGCUGCUGA

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

structures in the cell

Answers

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

Wyatt has heart problems

Answers

???? what is you talking about

Answer:

If Wyatt has heart problems, Wyatt can eat healthy foods to try and decrease the problems, Wyatt can also make sure that his weight and blood pressure isn't to high. Wyatt can try to get seen at the hospital to make sure everything is fine.

What is a constant?
O a variable
a number that stands alone with no variable
O the number in front of the variable
O two terms that look exactly the same


need help please

Answers

Answer:

a number that stands alone with no variable

Hope this helps!

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

Other Questions
Will Mark BrainliestSolve each system by elimination. Show your work3 10 y = 143 9y = 15 Will mark as brainliest Factor each polynomial: 9x-6 By what percent will the product of two numbers increase if one of them is increased by 30% and the other is increased by 60%? Which statement best summarizes the central idea ofthis passage?O In America, great things can be achieved if oneO Political struggles are not the only tthings that createO There are many different aspects to a LatinoO ldentity comes from many aspects, includingplans in advance and works hard,a Latino or Latina identity,identity, including the importance of farnily.political struggles that inspire how one lives life, How does DNA in cells determine an organism's complex traits? A. DNA contains codes for proteins, Which are necessary for the growth and functioning of an organism B. DNA separates into long single strands that make up each part of an organismC. DNA produces the energy an organism needs in order to growD. DNA folds into the nucleus of each of the cells of an organism PLEASE HELP!! do you guys take off your back pack and put it on your lap on the school bus, or do you wear it during the ride? What two groups were responsible for governing the colonies during the war for independence? three ways Latin American culture was changed by European colonization. please help!! 15 points Explain ASAP PLEASE!!!!!! Could you help me on this, I need to submit soon as well :) A group of seven friends went out for dinner together and they each paid the same amount for their meal. Their total bill was $68.95 what was the cost of one mealPlease answer I really need it Express in the form 1:nGive n as a fully simplified fraction.12:2 I will mark brainliest yo guysWhy should the voting age in America be changed from 18 to 16 Solve the following proportion for u.3/17 = u/13 for each one fifth, use a horizontal line or lines to show fractions equivalent to 1/5 and write the equivalent fractions find the slope please Work out the area of this circle with radius 11.2 take pie to be 3.142 and give your answer to 2 decimal places If an orca is 200 m below the surface of the water and then swims up and jumps 5 m in the air, what is the total distance it traveled? Steam Workshop Downloader