Answer:
A lot of technology improved production. There were no laws restricting harvesting timber. The economy was good and housing was in high demand. The United States was the only country that exported timber.
Hope this helped !
Answer:
The economy was good and housing was in high demand.
Explanation:
WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?
1. covalent because an electron is transferred from a C atom and O atom to a H atom.
2. covalent because electrons are shared between the C, H, and O atoms
3. ionic because an electron is transferred from a C atom and O atom to a H atom.
4. ionic because electrons are shared between the C, H, and O atoms
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
The atomic no. of carbon=6
Electronic configuration=2,4
The atomic no of H=1
E.C=1
The atomic no of O=8
E.C= 2,6
Therefore to attain octate state, they will share electrons
Answer:
4. Ionic bond because electrons are shared between the C,H and O atoms.
Explanation:
Took the test.
True or false Biodiversity has both economical and ecological value within an ecosystem.
Explanation:
biodiversity has both economic value and ecological value within an ecosystem. ... Human activities can also threaten biodiversity. These activities include habitat destruction, poaching, pollution, and the introduction of exotic species.
What is likely to happen when there is more genetic diversity?
A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving
Answer:
b
Explanation:
if there is more genetic diversity then the organism will adapt much better to the environment around it
Answer:
B
Explanation:
ggggggggggggggggggggggg
what is the name of the fluid found in the gall bladder
Answer:
"Bile" is what that fluid is called
A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?
A.
frequency
B.
wave speed
C.
period
D.
wavelength
Answerd
;-)◑__◐
Explanation:
___________________ is a molecule that organisms get from the air or water around them and use to release energy.
Answer:
Oxygen
Explanation:
In cellular respiration, oxygen is used to break down glucose, releasing chemical energy and heat in the process. Carbon dioxide and water are products of this reaction
Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.
Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.
What is the difference between a prokaryotic cell and a eukaryotic cell?
Answer:
Size is 0.1- 5.0 um Size is 5-100 um
Nucleus is absent Nucleus is present
Membrane-bound nucleus absent. Membrane-bound Nucleus is present.
Explanation:
here are some
Answer:
One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one
Explanation:
Glad I could help! <3
In order for water to collect in earths atmosphere and form clouds it must first undergo what process?
A) condensation
B) convection
C) evaporation
D precipitation
Answer:
The answer is D: Precipitation
why do humans have good memory
HELPPp!!!!!!I’ll mark u brainly
Answer:
Genotypes - Phenotypes:
TT - Thin
Tt - Thin
tt - Wide upside down
LL - Lopsided
Ll - Lopsided
ll - Parallel
VV - Vertical
Vv - Veritcal
vv - Horizontal
PP - Pink
Pp - Pink
pp - Red
blue, light blue, yellow, or red
HURRY
Answer:blue
Explanation:
The natural extinction of a predator can negatively affect the
Environment by leading to
-unrestricted prey species growth.
- major climate change.
-harmful human pollution.
-increased sediment deposits.
When the ocean absorbs CO2 it leads to what?
Explanation:
Each liquid falls somewhere along a scale with acid at one end and alkaline at the other. Normally, ocean water is less acidic than fresh water. Unfortunately, as the ocean absorbs more and more carbon dioxide from the atmosphere, it becomes more acidic. Lemon juice is an example of an acidic liquid.
Answer:
If the ocean absorbs a lot of CO2 it is most likely to become acidic
please help me with this
Answer:
prob b
Explanation:
20. What is true about the esophagus? Check all that apply.* ]
Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one
Explanation:
DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019
Answer:
Please find the answers to the following questions below:
Explanation:
1. DNA stands for deoxyribonucleic acid
2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.
3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.
4. Three (3) letters are in the code of DNA. These three letters make up a codon.
5. Adenine - Thymine
Cytosine - Guanine
6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC
7. Proteins are a part of the structural composition of the body
Proteins serve as catalyst for biochemical reactions
Proteins are source of nutrients
8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.
9. DNA is a molecule that stores genetic information in the cell of an organism.
What is the advantage and disadvantage of drug abuse
There is no way to get rid of invasive species, so there is no reason to even attempt.
A.) True
B.) False
Answer:
False
Explanation:
Scientists have tried to remove them or kill them.
Cuales son las características anatómicas de las fosas nasales
_______________________ is an animal's ability to blend into its surroundings.
a
artificial selection
b
evolution
c
natural selection
d
camouflage
[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]
Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.Which organisms break down decaying organisms and produce an inorganic nutrient pool in ecosystems?
Group of answer choices
secondary consumer
decomposers
primary consumer
producers
Answer:
Decomposers
Explanation:
Decomposers eat decaying or dead organisms to produce the nutrients.
Which of the following are not properties of lipids?
Answer: Lipid refers to any class of organic compounds that are considered fatty acids. This also includes their derivatives that are soluble in organic solvents, like many natural oils, waxes phospholipids and steroids.
All lipids have similar properties because their molecules are made of the same elements with similar chemical structure that only varies slightly.
Foods like meat, poultry, seafood, beans, peas and eggs are all sources of proteins, while good that contains saturated fat like palm oil, coconut oil, milk, cheese and coffee creamers and butter contain lipids, that may help in storing energy.
Explanation:
Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
I need the answer no links and no putting random stuff I need the answer fast
Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.
Explanion:
its already the answer
Which gas is used by humans in the process of cellular respiration?
Answer: Oxygen
Explanation:
During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.
Hope This Helps!
#[tex]AnimePower[/tex]
Answer:
oxygen
Explanation:
we breathe it in during cellular respiration
Underground water is an example of
A) a hidden water source
B) a untapped water
source
C) an unusable water source
D) a high salinity water source
Answer:
i think its a hidden water source
what does arrows mean in science
Absorbe nutrientes por medio de micro vellosidades que recubren y aumentan la superficie de absorción
Sobre la pregunta:
Cucigrama. Pregunta 1 vertical. Absorbe nutrientes por medio de micro vellosidades que recubren y aumentan la superficie de absorción
Answer:
Intestino delgado
Explanation:
El intestino delgado es el organi mas largo del tubo digestivo, pudiendo medir 7 metros de longitud y 3 cm de diametro. Se caracteriza por estar sumamente plegado sobre si mismo. La primera porcion, llamada duodeno, recibe secresiones de glándulas biliar y pancreática, y las mezcla con enzimas digestivas. Esta mezcla se encarga de degradar la comida y transformarla en sustancias solubles, como amino ácidos.
Es en el intestino delgado donde ocurre la absorción de nutrientes. Las paredes intestinales estas cubiertas por microvellosidades que aumentan la superficie de absorción.
Las microvellosidades son células que componene el epitelio columnar, y que extienden proyecciones hacia el lumen del organo.
experiment yeast fermentation ，what is the purpose of boiling the glucose solution earlier？
Answer:
The correct answer is - to sterilize it and remove any oxygen.
Explanation:
Boil the glucose solution to sterilize it and remove any oxygen, leaving behind the glucose needed for anaerobic respiration. High temperature kills all the microbes and sterilizes the solution.
Boiling the glucose solution earlier also helps in removing the oxygen from the solution for preparing the anaerobic respiration in the experiment desired. Sterilization of the solution also helps it in avoiding any microbes to present in the solution and affect the experiment.
What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio
The new cell has an increased surface area to volume ratio is a process that makes easier the exchange of materials across the surface of the cell (Option C).
What is cell division?Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.
Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.
In conclusion, news cell has an increased surface area to volume ratioand it makes easier the exchange of materials (Option C).
Learn more about the cell division here:
https://brainly.com/question/8283140
#SPJ1