The DNA sequence is 3' TACAAGAACTGCTACGCAAGCCTTAGCATC 5'.
What are the roles of proteins ?
Proteins play a significant structural role in the body, including the muscles, bones, and hair. Many biological reactions can proceed more quickly thanks to the proteins that make up enzymes. The ribosomes in the cytoplasm of the cells translate the mRNA sequence into the protein
The stop codon is UAG and the start codon is AUG in mRNA.
mRNA sequence :
5' AUGUUCUUGACGAUGCGUUCGGAAUCGUAG 3'
Hence , The DNA sequence is 3' TACAAGAACTGCTACGCAAGCCTTAGCATC 5'.
To learn more about the DNA sequence from the given link https://brainly.com/question/13967821
#SPJ4
Erythropoietin is produced by the kidneys to:
A) conserve or eliminate hydrogen and bicarbonate ions.
B) regulate removal of metabolic wastes.
C) regulate red blood cell production by the bone marrow.
D) regulate blood solute concentration.
Erythropoietin is produced by the kidneys to regulate red blood cell production by the bone marrow.
The correct option is C.
What is erythropoietin?Erythropoietin is a hormone that is produced mainly by the kidneys and which stimulates the bone marrow to produce new red blood cells.
The hormone is a glycoprotein as it is composed of protein molecules linked to carbohydrate moieties.
Erythropoietin is a very important hormone that is required in anemic conditions as well as when red blood cell production is low.
Learn more about erythropoietin at: https://brainly.com/question/2563641
#SPJ1
read the passage to answer the question.even though scorpions are related to spiders, there are many differences between the two organisms. one difference is that scorpion young do not hatch from eggs as spiders do. scorpions are born live, two at a time, and they immediately crawl onto the mother's back for protection and care. they remain there for two weeks as they grow big enough to take care of themselves.questionas baby scorpions grow larger, which process occurs in their body (somatic) cells?
Baby scorpions grow larger, and Mitosis occurs in their body (somatic) cells, which replicate the cell nuclei.
Mitosis is any of the container cycles at which point copied chromosomes are divided into two new nuclei. Cell division by the formation of cells by dividing gives encourages activity in innately identical containers at which point the total number of chromosomes is upheld.
A somatic cell, or herbaceous cell, is some organic cell making the bulk of a multicellular organism apart from a female reproductive cell, beginning cell, gametocyte, or similar stem container. Mitosis occurs in somatic cells; this resources that it takes place effectively in types of containers that are not complicated in the result of gametes.
To know more about Mitosis refer to: https://brainly.com/question/19058180
#SPJ4
Answer: Mitosis makes copies of the cells nuclei
Explanation: I took the test
match the physical charicteristics of the organisms to there purpose
The physical traits of the creatures were appropriate for their ultimate use.
Cilia - Thin, hair-like structures called cilia are used for locomotion.Flagella - Long, tail-like structures used for locomotion are called flagella.Pseudopods: projecting feet that can capture potential prey.Pili - used to hold onto rocks.What is Cilia?Cilia are tiny protuberances that resemble hairs and are located on the surface of eukaryotic cells. The primary function of cilia is the movement of substances on the cell surface or of the cell itself. Ciliated protozoans use their cilia for both eating and motility, and they are also referred to as ciliates. Cells and bacteria move around by using flagella, which are long structures that resemble tails. Bacteria, archae, and eukaryotes all possess flagella. Flagella are longer and typically single compared to cilia despite having a comparable structure and function.
To know more about Cilia, visit:
https://brainly.com/question/226194
#SPJ1
The complete question is as follows:
Match the physical characteristics of the organisms to there purpose:
Everyone experiences a period of __________ during puberty. A. Little changeb. Emotional and mental stabilityc. Reduced height and weightd. Rapid change.
Everyone experiences a period of rapid change during puberty
In order to be classified as a vitamin, a compound must meet which of the following criteria? Check All That Apply The body can't make a substance. ok ences The body can't synthesize enough of the compound to maintain health Absence of the compound from the diet for a defined period produces deficiency symptoms that if caught in time, are quickly cured when the substance is resupplied. A synthetic version of a compound is provided in amounts of one gram or more per day in supplemental form.
The term "vitamin" is conditional upon the conditions and the specific organism, and refers to an organic chemical compound when the organism cannot produce the molecule in sufficient quantities and it must be received through the diet.
What are the classification standards for vitamins, and how are they determined?Vitamins are organic substances that are frequently classed as either fat-soluble or water-soluble. Vitamins that dissolve in fat, such as vitamin A, vitamin D, vitamin E, and vitamin K, have a tendency to build up in the body.
What functions does vitamin A serve in the body?Retinol, also known as retinoic acid, is a nutrient crucial for immunity, cell division, growth, and vision. Antioxidant qualities are also present in vitamin A.
To know more about vitamin visit:-
https://brainly.com/question/24324739
#SPJ4
what would happen if the tryptophan codons in the trp leader sequence were changed to codons for alanine?
Attenuation will no longer occur in response to high tryptophan levels.
What is tryptophan codons?Due to the fact that just one codon specifies the amino acid tryptophan, it is special. Each of the remaining 19 amino acids is designated by two to six codons. The stop codons, UAA, UAG, and UGA, are used to indicate when translation has finished.
The trp repressor changes into its active (DNA-binding) form as a result of the tryptophan's binding to it. In order to prevent RNA polymerase from attaching to the promoter and stopping transcription of the operon, the tryptophan-bound trp repressor connects to the operator.
The binding of the repressor to the operator region stops or turns off transcription of this operon. If the operator region were deleted, the trp repressor would not bind when tryptophan levels were high.
To learn more about tryptophan codons refer to:
https://brainly.com/question/3075855
#SPJ4
Which statement is TRUE of infant vision?
Because of the sensitivity of their eyes, young infants avoid looking at areas of high contrast.
By around 2 or 3 months of age infants' color vision is similar to that of adults.
Infants tend to look at the center of any display, regardless of what it is.
Visual acuity develops very slowly, but by 18 months infants can see nearly as well as adults.
The true statement of infant vision is by around 2 or 3 months of age infants' color vision is similar to that of adults.
Thus, the correct answer is C.
How is the development of infant vision around 2 or 3 months?Аt аbout 2 months old, bаbies usuаlly аre аble to follow а moving object with their eyes аs their visuаl coordinаtion improves. In fаct, аt аround 3 months old, the bаby mаy hаve enough eye аnd аrm coordinаtion to bаt аt а neаrby moving object.
Аt 3 months old, the bаby's eyes should work together to focus аnd trаck objects. It means the infants' color vision is similar to that of adults.
For more information about infant vision refer to the link:
https://brainly.com/question/7339384
#SPJ4
a solid ball of about eight cells formed about 50 to 60 hours after fertilization is called a(n) .
The solid ball of about 8 cells is known as morula.
What is morula?
Morula is a solid mass of blastomeres that results from a number of cleavages of a zygote/ fertilized egg. It gets its name from its resemblance to a mulberry.
Morula is usually produced in those species in which the eggs contain some yolk and, undergo complete cleavage. The blastomeres on the surface of the morula are responsible for giving rise to extra-embryonic parts of the embryo. The cells of the interior, the inner cell mass, all develop into a proper embryo.
The morula is composed of 60 or more cells in humans. The zygote develops in a blastocyst as the number of cells in a morula increases. A blastocyst is a hollow bubble like structure, which becomes implanted in the uterine lining eventually.
Therefore, the solid ball of about 8 cells is known as morula.
Learn more about morula here: https://brainly.com/question/20787707
#SPJ4
skeletal muscle cells of animals contracting in under low oxygen conditions rely on fermentation to keep going. what product of fermentation enables the muscle cells to keep ""working?""
Fermentation is a method for producing ATP anaerobically (i.e., without oxygen).
Your muscle will begin manufacturing ATP through lactic acid fermentation as soon as the stored ATP is used up. Cells can continue producing ATP through glycolysis after fermentation. A result of fermentation is lactic acid. Oxygen is used by cells to produce ATP, or useable energy, from the food we consume. Usually, this is accomplished by means of cellular respiration. In the final step of the electron transport chain, where the majority of ATP is produced, during cellular respiration, oxygen receives electrons. The electron transport chain stops producing ATP in the absence of oxygen.
Glycolysis during fermentation only yields two ATP per glucose molecule, which is significantly less ATP than is produced during cellular respiration.
To learn more about fermentation, refer:-
https://brainly.com/question/13777485
#SPJ4
which of the following studies would a community ecologist undertake to learn about competitive interactions? i) selectivity of nest sites among cavity-nesting songbirds ii) the grass species preferred by grazing pronghorn antelope and bison iii) stomach analysis of brown trout and brook trout in streams where they coexist
Selectivity of nest among cavity-nesting songbirds communities, grass types of grazing bison and pronghorn antelope species, and stomach examination of brown, brook trout in streams where they coexist.
Community ecology is the study of how communities assemblages of interdependent populations of the species residing in a specific area or habitat are structured and operate.
Species populations interact with one another to create biological communities. The term "biodiversity" is exemplified by the sheer number of interacting species in these communities and the complexity of their relationships. As species interact, food chains, food webs, guilds, and other interacting webs are formed, which give rise to structures within communities. These connections alter over the course of evolution as species coevolve together and adapt to one another. Below are descriptions of the general organization of biological communities, the structure of interspecific interactions, and the impacts that the coevolutionary process has on the biological community.
Learn more about species
https://brainly.com/question/13259455
#SPJ4
according to the biological species concept, which mechanism is not a mechanism of reproductive isolation?
According to the biological species concept, geographic isolation mechanism is not a mechanism of reproductive isolation.
Geographic isolation refers to the separation of species due to physical barriers such as water forms, oceans, mountains, and so on. Finally, the organisms are prevented from exchanging genetic material with other organisms of the same species. Geographic isolation, also known as allopatry, is a term used in evolutionary biology. When a portion of a species' population becomes geographically isolated from the rest, it may evolve characteristics distinct from the parent population over time (due to natural selection).
Geographic isolation is an important factor in allopatric speciation. If gene flow is disrupted for an extended period of time due to geographical barriers, populations can evolve independently and eventually form distinct species. Different species do not mate because they are active at different times of the day or in different seasons. Individuals mate in their preferred habitat and thus do not meet members of other species who have different ecological preferences.
To learn more about geographic isolation, here
https://brainly.com/question/3869848
#SPJ4
small dense object formed from the remnants of a star at least three times as massive as the sun
A. Black hole
B. White Dwarf
C. Neutron Star
Answer:
If the core is much greater than 3 solar masses, the core contracts to become a Black Hole.
Explanation:
That is what i think i hope i helped
Based on phylogenetic bracketing, knowledge that both birds and crocodiles have four-chambered hearts would lead us to conclude that __________ also have four-chambered hearts.
ornithischian dinosaurs and saurischian dinosaurs
Based on phylogenetic bracketing, knowledge that both birds and crocodiles have four-chambered hearts lead to conclude that ornithischian and saurischian dinosaurs also have four-chambered hearts.
The Ornithischia, sometimes known as "bird-hipped" dinosaurs, and the Saurischia, often known as "lizard-hipped" dinosaurs, are the two main groups of dinosaurs found in the Dinosauria. The direction of the pubis, which is depicted in white in the image above, is the most obvious visual distinction between the two types of hips. This bone points toward the animal's front and widens into a keel at the forward end in saurischian dinosaurs. A reversed pubis that stands next to and parallel to the ischium and points in the direction of the tail is present in ornithischians. A protrusion can be seen at the anterior end of the pubis in some ornithischians.
H.G. Seeley recognized the two groupings for the first time in 1888. The origins of the two names "bird-hipped" vs. "lizard-hipped" are unclear since, although not sharing any common ancestors, certain saurischians had hips that resembled birds, and some ornithischians had hips that resembled birds in some ways. Despite having a reversed pubis like ornithischians, it appears that birds are descended from saurischian dinosaurs. The ornithischian-saurischian dichotomy is not as straightforward as it might seem because certain close relatives of birds within saurischians also possess this trait. The lineage of each group's members is denoted by the names "Ornithischia" and "Saurischia." There is no requirement that the names have any significance. All they are, really, are names.
Learn more about dinosaurs
https://brainly.com/question/21827900
#SPJ4
both horticulture and agriculture use plants as a source of food. what is the key difference between them?
Horticulture is gardening on a small scale while agriculture is farming on a large scale. Terms in this set (29) Both horticulture and agriculture focus on the use of plants as a food source. Horticulture is gardening on a small scale while agriculture is farming on a large scale.
Unlike generalized reciprocity, balanced reciprocity is more of a direct exchange in which something is exchanged or given with the expectation that something of equal value will be returned within a specified period of time. The transition to intensive agriculture brought with it a series of inevitable major social changes. changes. Year-round permanent settlements became necessary because the food source was immobile. As a consequence, more time and effort was invested in building houses that would last for generations. By giving back, we make sure that other people get help when they need it and that we get help when we need it. Reciprocity also allows people to do things that they could not do on their own. Which statement best represents the practice of horticulture? Horticulturists move their gardens periodically, use simple tools, and largely consume their own crops.
To learn more about horticulture please click on below link
https://brainly.com/question/28991945
#SPJ4
charles darwin studied the relationship between the adrenal medulla and emotions. which chemical, produced in the adrenal medulla, causes the fight or flight response?
Charles Darwin investigated the connection between the adrenal medulla and emotions and discovered that the Epinephrine rationale chemical.
Adrenal medulla, induces the fight-or-flight response. The Latin name for this region of the adrenal gland is medulla glandule suprarenalis. The adrenal cortex encircles it, which is situated in the gland's Centre. It is made up of chromaffin cells, which secrete catecholamines like epinephrine, and is located inside the adrenal gland known as Adrenal medulla. Cardiac arrest, anaphylaxis, and superficial bleeding are just a few of the ailments that epinephrine is used to treat. Although it has been utilized in the past to treat bronchospasm and low blood sugar, more recent therapies that are selective for epinephrine type 2—like salbutamol—are now recommended.
Learn more about adrenal medulla here
https://brainly.com/question/7781659
#SPJ4
The proportion of adenine in DNA from an organism is 20%. Which of the following statements regarding the DNA from this organism is INCORRECT? The proportion of guanine in DNA is 20%. The proportion of cytosine in DNA is 30%. The proportion of thymine in DNA is 20%. The proportion of guanine and cytosine in DNA is 60% The proportion of guanine in DNA is 30%. The proportion of adenine and thymine in DNA is 40%
The following statements about DNA from this organism are FALSE is The proportion of guanine in DNA is 20%. The proportion of cytosine in DNA is 30%.
As the correct statements about DNA from this organism are The ratio of adenine in an organism's DNA is 20%, than you have 20% thymine, because the amount of adenine and thymine is equal. 20% plus 20% is 40% adenine and thymine. From 100% DNA bases subtract 40% and you get 60%. Then divide it by 2 and you get 30%. 30% guanine and 30% cytosine, because their amounts are equal in the DNA component.
To know more about adenine please click on the link brainly.com/question/13722082
#SPJ4
Bryophytes are usually found in areas that are very wet or damp at least part of the year. Which of the following statements describes characteristics of bryophytes that make them dependent on water? Check all that apply. They have swimming sperm that need water so they can swim to fertilize the eggs of other nearby plants. They do not have lignin-stiffened vascular tissue or roots to effectively distribute water throughout the plant. Some species are able to reproduce asexually through fragmentation.
The statement describes characteristics of bryophytes that make them dependent on the water as they have swimming sperm that need water so they can swim to fertilize the eggs of other nearby plants.
So, the correct option is A.
In order to survive and reproduce, bryophytes need water. In order for sperm to reach the eggs to fertilize them, water is required in bryophytes for sexual reproduction. To procreate, bryophytes need water. For the male gametes (sperm) to get to the female gamete, water is necessary. They are non-vascular plants, which merely explains their diminutive size and has nothing to do with the reason they require water. A moist environment is necessary for bryophytes to reproduce as well. Their sperm is flagellated, and to get to the egg, it must swim through water. Thus, moist habitats are the only types where mosses and liverworts can grow. Deserts don't have any mosses.
Learn to know more about Bryophytes on
https://brainly.com/question/2648588
#SPJ4
Each student in a biology laboratory received two solutions. One solution was distilled water. The other was a salt solution
with concentrations of salts slightly greater than that of a living cell. The solutions were labeled X and Y, respectively.
The students were instructed to place some fresh-water protozoans in each of the solutions and to identify the solutions on the basis
of their observations. The protozoans in solution X shriveled. Those in solution Y swelled up and burst.
5. These results indicate that (1.) solution X was salt water (2.) solution Y contained killer protozoans (3.) solution Y was salt water
(4.) solution X was distilled water (5.) solution X was tap water
These results indicate that (1.) solution X was salt water.
Tonicity estimates the osmotic pressure gradient of two liquids isolated by a semipermeable layer. There are three types of tonicity that a solution can have in relation to another: hypertonic, isotonic, and hypotonic.
The solute concentration of an isotonic solution is the same as that of another solution.Cells will swell in a solution that is hypotonic, while they will contract in a solution that is hypertonic.A solution that is hypertonic contains more solutes than a cell or other solution. In hypertonic solutions, cells shrink.Saltwater is hypertonic to the red platelets. Consequently, the cell releases water into the solution. As a result, the cell in solution X shriveled up.
Know more about tonicity here: https://brainly.com/question/28630548
#SPJ4
Following delivery of the placenta, the mother is experiencing vaginal bleeding. After massaging the uterine fundus and allowing the mother to breastfeed, the bleeding stops. This occurred because:
Select one:
A. a portion of the placenta was retained in the uterus.
B. these actions simulate the production of oxytocin and cause uterine contraction.
C. uterine massage increases blood flow to the uterus.
D. breastfeeding causes uterine blood vessels to dilate.
The bleeding ceases after massaging the uterine fundus and enabling the mother to breastfeed because these movements increase oxytocin production and produce a uterine contraction. In response to this query, choice B is appropriate.
Vaginal postpartum hemorrhage, also known as lochia, is the term for the discharge of blood and mucus that starts to occur after birth. Bleeding after delivery is normal and common: All the extra blood, mucus, and tissue that accumulated over your pregnancy are being eliminated by your body. Therefore, whether you gave birth naturally or via C-section, you will experience postpartum bleeding.
More frequently than not, lochia is heavier and lasts longer than a menstrual period. It also includes substances that are absent from a typical menstrual period, such as uterine mucus and tissue, primarily from the cervix. the region to which the placenta was connected.
Please visit to learn more about postpartum bleeding
https://brainly.com/question/28414395
#SPJ4
Without the circulatory and respiratory systems, human bodies would not survive. Both systems play major roles in providing our bodies with what they need. They work individually as well as together to keep us alive and healthy, which four statements describe functions of the circulatory system?.
To breathe in atmospheric oxygen and exhale carbon dioxide through the lungs, the respiratory system collaborates closely with the circulatory system.
Due to the function of white blood cells, the circulatory system typically aids the body in the fight against infections.Being complex multicellular organisms, animals need a way to move nutrients throughout their bodies and get rid of waste. All areas of the body are reached by the intricate blood channel network that makes up the human circulatory system. This enormous network eliminates carbondioxide and waste products while supplying oxygen and nutrition to the cells, tissues, and organs.
The blood, which circulates continuously throughout the body, serves as a conduit for the transportation of gases and other substances. The heart's pumping generates pressure differences throughout the body that cause the blood to move.
A crucial role of the circulatory system is gas exchange between the blood and tissues. Blood in mammals, birds, and humans takes in oxygen and exhales carbon dioxide in the lungs.
Learn more about circulatory system using this link:
https://brainly.com/question/10103458
#SPJ4
Sebaceous glands...
a. sweat
b. sebum
c. milk
d. cerumen
approximately 14 grams of are needed per day above normal requirements to support the growth of one pound of muscle per week, if a person is in protein balance.
Proteins are large biomolecular and macromolecular structures made up of one or more long chains of amino acid residues. Thus correct answer 14 g.
The standard recommendation for bodybuilders is to consume one gram of protein per pound of bodyweight in order to support muscle growth, but the science behind this advice varies depending on age, level of fitness, and overall body composition goals.
What is the recommended daily protein intake in grams per kilogram for a 14-18 year old?
The World Health Organization/Food and Agriculture Organization (WHO/FAO) recommends 0.9 g/kg/day of protein consumption for boys aged 3 to 18 years old and 0.9 g/kg/day for girls aged 3 to 15 years old (24). Girls between the ages of 15 and 18 had a somewhat lower amount of 0.8 g/kg/day.
Learn more about protein to visit this link
https://brainly.com/question/17095120
#SPJ4
Full Question :How much additional protein is needed per day to support the growth of one pound of muscle?
14 g
40 g
58 g
65 g
When Ras is activated, cells will divide. A dominant-negative form of Ras clings too tightly to GDP. You introduce a dominant-negative form of Ras into cells that also have a normal version of Ras. Which of the following statements is true?
(a) The cells you create will divide less frequently than normal cells in response to the extracellular signals that typically activate Ras.
(b) The cells you create will run out of the GTP necessary to activate Ras.
(c) The cells you create will divide more frequently compared to normal cells in response to the extracellular signals that typically activate Ras.
(d) The normal Ras in the cells you create will not be able to bind GDP because the dominant-negative Ras binds to GDP too tightly.
Ras, which stands for "Rat Sarcoma Virus," is a protein family that is found in all animal cell lines and organs. Thus correct answer (a) The cells you create will divide less frequently than normal cells in response to the extracellular signals that typically activate Ras.
Ras protein is a low-molecular-weight GDP/GTP-binding guanine triphosphatase produced by the Ras gene that plays an important role in cell growth and differentiation signaling. In the regular course of signal transduction.
What is the function of the RAS protein?
RAS proteins play a crucial role in proper development. Active RAS promotes cell growth, proliferation, and migration. RAS in normal cells receives and obeys signals to swiftly flip between active (GTP form) and inactive (GDP form) states.
Learn more about RAS protein to visit this link
https://brainly.com/question/14994384
#SPJ4
The great seal of the united states features an eagle clutching an olive branch in the talons of its right foot, symbolizing the power of peace. What is it grasping in the talons of its other foot?.
The power of peace is being seized grasping in the talons of its other foot.
A shield, a scroll, an olive branch, or a phrase is what the eagle on the Great Seal is holding in his right talon?In the artwork, an eagle holding the motto "E Pluribus Unum" on a scroll with an olive branch representing peace and thirteen arrows representing conflict are displayed in each of its claws. The year 1776 is written in Roman numerals at the foot of a thirteen-step pyramid on the reverse of the seal.
What does the eagle represent in the US coat of arms?The Founding Fathers made the right choice when they designated the bald eagle as the country's emblem. The fierce woman and the great bird's proud independence effectively represents America's strength and freedom.
To know more about grasping visit:-
https://brainly.com/question/23967141
#SPJ4
which technique would be used to identify the specific nucleotides between which a chromosome break occurred?
Answer:
DNA sequencing
true or false: one way to help conserve coastal areas and the organisms that live there is through the inclusion of marine protected areas (mpas)
Marine protected areas help protect important habitats and cross-sections of marine life and can help restore ocean productivity and prevent further degradation.
They are also sites for scientific study and can generate income through tourism and sustainable fishing. The oceans are an essential component of the Earth's ecosystem, a source of biodiversity, food and life. According to the FAO, more than 40 percent of the world's population lives within 100 kilometers of the coast. Therefore, better management of ocean resources is crucial to ensure global food security. Governments establish MPAs to help protect marine ecosystems that are threatened by human activity, such as overfishing or oil drilling. An MPA can also be established to protect underwater archaeological sites, shipwrecks, and other historically important locations. Marine conservation can also increase resilience in maintaining marine ecosystems. Marine protected areas can be used to protect geological features and processes that are identified as unique or distinctive. This can help protect marine biodiversity such as fish, coral reefs, and other marine animals.
To learn more about degradation. please click on below link
https://brainly.com/question/14204532
#SPJ4
What key features should be present in the ir spectrum of your product if you successfully made the desired bromohydrin? what key features should be absent from the ir spectrum if the starting material was completely reacted?.
Bonds with greater bond strengths will experience more stretching. Lower stretching frequency values in the IR spectrum will be produced by atoms with higher atomic masses in the bond.
What is the IR spectrum?Infrared (IR) spectroscopy is a well-liked absorption method in both qualitative and quantitative evaluations. The infrared region of the electromagnetic spectrum contains electromagnetic radiation that has the ability to alter the vibrational and rotational states of covalent bonds in biological molecules.
An infrared spectrum: how is it made?An infrared spectrometer analyzes a substance by exposing a sample to infrared radiation at various frequencies and identifying the absorptions brought on by each kind of bond in the complex. A spectrum is produced as a result, which is typically a "plot" of transmittance percentage versus wavenumber.
To know more about spectrum visit:-
https://brainly.com/question/6836691
#SPJ4
explore: read the descriptions of the large organs, as well as those of the small organs on the next tab. fill in the names of the organs that serve the functions listed below:Large intestineThis organ absorbs water and vitamin K from digested food.PancreasThis organ produces enzymes that break down nutrients.CapillariesThese tiny blood vessels transport absorbed nutrients.Parietal cellsThese cells produce hydrochloric acid (HCl).Chief cellsThese cells produce pepsin, which breaks down proteins
Mouth, throat, pharynx, esophagus, stomach, large intestine, rectum, and anus are all parts of the digestive system. The salivary glands, liver, gallbladder, and pancreas are all a part of in digesting food.
These organs provide the digestive fluids and enzymes that the body needs to break down food and liquids. Each component of your digestive system works to either break down food and drink into smaller pieces, move food and liquid through your GI tract, or do both. Once food has been broken down into small enough pieces, your body to absorb and transport minerals from it. Because your large intestine absorbs water, the waste materials of digestion become stool. Nerves and hormones control the digestive process. The digestive tract and other organs that aid in the body's digestion and absorption of food make up the digestive system. It is a protracted, twisted tube that originates at the mouth and travels via the stomach, small and large intestines, the anus, and the oesophagus. Food is broken down by the digestive system into nutrients like proteins, lipids, and carbs.
Learn more about digestive system
https://brainly.com/question/29575362
#SPJ4
For piano playing, which muscles would have the fewest fibers controlled by each motor neuron?.
A motor neuron, which transmits information from the brain or spinal cord to the muscle, controls each fiber of the skeletal muscle.
The maximum number of muscle fibers that one motor neuron can innervate?This means that each motor neuron will innervate just a few muscle fibers (10–100), allowing the complete muscle to move with many different subtleties.
What purposes serve smaller motor units?A single motor neuron can provide a few muscle fibers in a muscle, which is known as a tiny motor unit. Very fine motor control of the muscle is made possible by small motor units. The tiny motor units of the extraocular eye muscles that move the eyes are the best example in humans.
To know more about muscles visit:-
https://brainly.com/question/9883108
#SPJ4
transcription factors cannot just be attracted to the dna. they also need to bind to very specific sequences in the dna in order to properly regulate gene expression. these specific interactions rely on (transcription factors binding to their specific site on the dna)?
A transcription factor , also known as a sequence-specific DNA-binding factor, is a protein that regulates the pace at which genetic information is transferred from DNA to messenger RNA by binding to a particular DNA sequence.
Which molecules do transcription factors link give it a try?Proteins known as transcription factors attach to a upstream regulatory elements for genes inside the promoter or enhancer regions of DNA to either promote or hinder the production of proteins.
Does DNA or RNA bind to transcription factors?For the purpose of this review, we have decided to concentrate on sequence-specific transcription factors that bind DNA and also seem to bind RNA with some degree of sequence specificity.
To know more about DNA or RNA visit:
https://brainly.com/question/29493400
#SPJ4