blue, light blue, yellow, or red

HURRY

Blue, Light Blue, Yellow, Or RedHURRY

Answers

Answer 1

Answer:blue

Explanation:

Answer 2
the answer to the question is the color blue

Related Questions

Organisms of either extreme characteristic dying out while organisms with the medium characteristic have a higher fitness is identified as?

Answers

Answer: Stabilization selection

Explanation:

Natural selection involves the differential survival and growth of organisms which have suitable traits to survive in unfavorable or adverse environment. Such traits are passed on to the next generation. Stabilization selection is a type of natural selection in which the nature selects the non-extreme phenotypic traits. Middle traits are selected and such organisms grow and reproduce. Example can be given that of human babies in which babies with low weight lose more heat and babies with high weight are difficult to be delivered from the pelvis. Therefore, babies with middle weight are expected to survive more than that of low or middle weight.

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

For recessive trait to be expressed you need to receive the allele from both parents. True or false

Answers

Answer:

When a trait is recessive, an individual must have two copies of a recessive allele to express the trait.

The cell cycle is the life of the cell from the time it is first formed from a dividing parent cell until its own division into two cells

Answers

Explanation:

cell cycle is made up of three main parts: interphase, mitosis, and cytokinesis. Most biologists agree that interphase makes up the period of time that a cell would be preparing for cell division. Cells spend the majority of their lives in this stage. During interphase a cell is going to be growing, replicating its genetic material and essentials to carry out cell division, and proofreading the genetic material to ensure replication has occurred correctly. This doesn’t sound like much, but it’s actually the longest part of the cell cycle. Once this is complete, the cell will then go through cell division and, theoretically, split into two new cells (cytokinesis).

How cytokinesis works will depend upon the type of cell that is dividing. Here is an image that summarizes the differences in cytokinesis in plant cells and animal cells, which is the classic example used in many introductory biology courses:

which is the method of estimating fish in a pond​

Answers

Explanation:

There is a popular sampling method called capture – recapture or 'Lincoln Index' or 'Pieterson's Method' which is used to estimate the size of an animal or human population.

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

what does arrows mean in science

Answers

It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

Which of the following is NOT a type of wetland?
a: marsh
b: bog
c: swamp
d: pelagic

Answers

I think it is d because the other places are of course wet lands.

Explanation:

i have no clue, but good luck, hopefully you pass the test

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

20. What is true about the esophagus? Check all that apply.* ]

Answers

Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one

Explanation:

What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio​

Answers

The new cell has an increased surface area to volume ratio​ is a process that makes easier the exchange of materials across the surface of the cell (Option C).

What is cell division?

Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.

Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.

In conclusion, news cell has an increased surface area to volume ratio​and it makes easier the exchange of materials (Option C).

Learn more about the cell division here:

https://brainly.com/question/8283140

#SPJ1

What is likely to happen when there is more genetic diversity?

A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving

Answers

Answer:

b

Explanation:

if there is more genetic diversity then the organism will adapt much better to the environment around it

Answer:

B

Explanation:

ggggggggggggggggggggggg

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Underground water is an example of

A) a hidden water source

B) a untapped water
source

C) an unusable water source

D) a high salinity water source

Answers

Answer:

i think its a hidden water source

Which gas is used by humans in the process of cellular respiration?

Answers

Answer: Oxygen

Explanation:

During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Hope This Helps!

#[tex]AnimePower[/tex]

Answer:

oxygen

Explanation:

we breathe it in during cellular respiration

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

In order for water to collect in earths atmosphere and form clouds it must first undergo what process?

A) condensation

B) convection

C) evaporation

D precipitation

Answers

Answer:

The answer is D: Precipitation

_______________________ is an animal's ability to blend into its surroundings.

a
artificial selection
b
evolution
c
natural selection
d
camouflage

Answers

D camouflage I’m assuming because that’s what camouflage is used for.

[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]

Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

Which of the following best describes what carrying capacity is?
A
The quantity of marine life a limited water resource can sustain.
B
The maximum number of a population that an ecosystem can sustain.
C
The total amount of greenhouse gases a specific ecosystem can sustain.
D
The minimum number of predators a specific geographic area needs to sustain itself.

Answers

B. The maximum number of a population that an ecosystem can sustain.

Biology - Genetics
Click on a word in the puzzle to see the clue
Welcome!
Click a word in the puzzle to get started.
Check puzzle

Answers

Answer:

what type of question it is

Where is the puzzle?
Other Questions
Most photosynthesis takes place in the _____.epidermisspongy layerpalisade layercuticle Why is the modern age called the age of science and technology? Two parallel lines cut by a transversal are shown. What is the measure of X"? Risks for standing up for the one who is being bullied Select the correct answer from each drop-down menuThe table shows the number of books Lucy borrowed from the library each month for a yearMonth Number of BooksMonthNumber of BooksJanuary146February8JulyAugustSeptember19March1612April14OctoberMay8November7June7DecemberLucy bomowed the most books inThere were months in which she borowed fewer than 10 books Order the numbers from least to greatest 41/50, 0.83, 80% apply three criminological theories to explain why someone would offend upon release from incarceration. Please be specific in your response and demonstrate that you understand both the theory and material. Which series is convergent? Check all that apply.Sigma-summation Underscript n = 1 Overscript infinity EndScripts StartFraction 2 n Over n + 1 EndFractionSigma-summation Underscript n = 1 Overscript infinity EndScripts StartFraction n squared minus 1 Over n minus 2 EndFractionSigma-summation Underscript n = 1 Overscript infinity EndScripts (one-fifth) Superscript nSigma-summation Underscript n = 1 Overscript infinity EndScripts 3 (StartFraction 1 Over 10 EndFraction) Superscript nSigma-summation Underscript n = 1 Overscript infinity EndScripts StartFraction 1 Over 10 EndFraction (3) Superscript nThere are 2 correct answers Can someone please help me!! (No decimals) Please help faster please Please help i put all my points for the reward a man comes in to the emergency room expressing that he has a bad headache while you are already preparing to care for two other patients. what should you do?A. ask the patient questions about his headache in order to determine the cause of his headacheB. Suggest to the patient to go home and take aspirin C. Automatically prioritize treatment for his headache since he is the newest arrivalD. Refer the patient to a local Physicians office because his headache does not sound like an emergency 1. From the era of Napoleon through World War II, how has the development of Europe changed due to imperialisticdesires and nationalism? Jacob is traveling to North Carolina for vacation. He travels a total of 456 miles in 8 hours, what is his average speed? inequality:-3 -6 (4x+6) > - 111solve 105x-10-50510-10hat is the equation of the axis of symmetry? 3) Determine the numbers of solutions for 4x + 8 = 12x. Which of the following pairs of words are cognates?O A. Bunk, banqueB. Museum, banqueO c. Banco, museoO D. Bank, banque Choose the equation of the line that is equal to the x-axis.A x=4B x+y=0C x=yD y=4If anyone could help, I'd really appreciate it! Using the extreme value theorem, what are theminimum and maximum values of f(x)?O minimum value = 1; maximum value = 6O minimum value = 2; maximum value = 6minimum value = -1; maximum value = 3O minimum value = -2: maximum value = 3 Name the conic section formed when a plane cuts a right circular cone parallel to its base.1) circle2)parabola3)ellipse4) hyperbolaWill mark it the brainliest plsss fast!