HELP! A 20-kg bag of rice dropped from an airplane. What is the gravitational force on the bag? Acceleration due to gravity is 9.8 m/s/s.)
10.02 N

19.6 N

20.8 N

196 N

Answers

Answer 1

Answer:

20.8

Explanation:

I took it and it was right

Answer 2

196N is the gravitational force on the bag. So, the correct option is D.

What is gravitational force?

Any two items in the universe can be attracted to one another by the gravitational force. All mass-containing objects are drawn towards one another by this attraction, which also keeps the moon in its orbit around the Earth and the planets in their orbits around the sun.

The mass of the two objects and their separation determine the gravitational force's strength. The force of gravity between two objects is directly proportional to their masses and inversely correlated to the square of their distance, according to Newton's law of universal gravitation.

The gravitational force on the bag can be calculated using the formula:

force = mass x acceleration due to gravity

Plugging in the given values, we get:

Force = 20 kg x 9.8 m/s/s

Force = 196 N

Therefore, the correct option is D.

Learn more about gravitational force, here:

https://brainly.com/question/12528243

#SPJ3


Related Questions

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

Is a bird calls warning for prey a physical or behavioral adaptation?
Is an animals body temperature changing a physical or behavioral adaptation?
Is birds flying to high ground when they sense movement a physical or behavioral adaptation?

NO LINKS! NO PDF'S. Please, help ASAP!

Answers

1. the birds call is a behavioral adaptation 2. the animals body temp changing is physical. 3. the birds flying is a behavioral adaptation.

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

___________________ is a molecule that organisms get from the air or water around them and use to release energy.

Answers

Answer:

Oxygen

Explanation:

In cellular respiration, oxygen is used to break down glucose, releasing chemical energy and heat in the process. Carbon dioxide and water are products of this reaction


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

There has a been decrease in the diversity of plants in the grasslands of the Edward's plateau. What has caused this to occur?

Answers

What the person above me said is correct!!! Good luck! Have a good day!

A person is observing the oscillations of a wave. If the wave source begins to move away from the person, what will the person notice?

A.
The wavelength will decrease.
B.
The wave appears to have a different amplitude.
C.
The wave appears to change speed.
D.
The wave appears to oscillate at a different rate.

Answers

the wave appears to oscillate at a different rate

pls answer pls please​

Answers

Answer:

1.it's beak is pointed and  slightly curved at pointed

2.it's upper part is brown and lower part is white

3.it's legs is black

Explanation:

What is likely to happen when there is more genetic diversity?

A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving

Answers

Answer:

b

Explanation:

if there is more genetic diversity then the organism will adapt much better to the environment around it

Answer:

B

Explanation:

ggggggggggggggggggggggg

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

HELPPp!!!!!!I’ll mark u brainly

Answers

Answer:

Genotypes - Phenotypes:

TT - Thin

Tt - Thin

tt - Wide upside down

LL - Lopsided

Ll - Lopsided

ll - Parallel

VV - Vertical

Vv - Veritcal

vv - Horizontal

PP - Pink

Pp - Pink

pp - Red

Which organisms break down decaying organisms and produce an inorganic nutrient pool in ecosystems?
Group of answer choices

secondary consumer

decomposers

primary consumer

producers

Answers

Answer:

Decomposers

Explanation:

Decomposers eat decaying or dead organisms to produce the nutrients.

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

blue, light blue, yellow, or red

HURRY

Answers

Answer:blue

Explanation:

the answer to the question is the color blue

Please!! I’ll give you lots of points!! PHow do the sensory spines most likely help the cockroach
survive in its environment?
A. They improve the cockroach's vision so it can see
predators sooner.
B. They allow the cockroach to change its body shape
to confuse predators.
C. They reduce the friction along the top of the
cockroach so it can move faster than predators.
D. They allow the cockroach to move through small
spaces where it is unable to use its feet to escape
predators.

Answers

C they reduce friction

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

The natural extinction of a predator can negatively affect the
Environment by leading to
-unrestricted prey species growth.
- major climate change.
-harmful human pollution.
-increased sediment deposits.

Answers

-unrestricted prey species growth


Explanation: the less predators the more the prey will reproduce, hence the fact that no one is there to consume them they will increase at a very accelerated speed

Cuales son las características anatómicas de las fosas nasales

Answers

El interior de las fosas nasales está tapizado por una membrana mucosa, que se divide en mucosa respiratoria y mucosa olfativa. La mucosa respiratoria (antiguamente pituitaria roja) recubre la mayor parte de la fosa nasal y contiene células ciliadas y células caliciformes que secretan moco.

True or false Biodiversity has both economical and ecological value within an ecosystem.

Answers

Explanation:

biodiversity has both economic value and ecological value within an ecosystem. ... Human activities can also threaten biodiversity. These activities include habitat destruction, poaching, pollution, and the introduction of exotic species.

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

Which of the following are not properties of lipids?

Answers

Answer: Lipid refers to any class of organic compounds that are considered fatty acids. This also includes their derivatives that are soluble in organic solvents, like many natural oils, waxes phospholipids and steroids.

All lipids have similar properties because their molecules are made of the same elements with similar chemical structure that only varies slightly.

Foods like meat, poultry, seafood, beans, peas and eggs are all sources of proteins, while good that contains saturated fat like palm oil, coconut oil, milk, cheese and coffee creamers and butter contain lipids, that may help in storing energy.

Explanation:

There’s no options, add a photo pls

20. What is true about the esophagus? Check all that apply.* ]

Answers

Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one

Explanation:

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

Which ingredient is a food acid used to activate baking
soda in quick breads?
o honey
o buttermilk

Answers

Answer:

Honey

Explanation:

Technically it could be both, as they can both be acidic, but honey is lower on the pH scale, meaning it is more acidic and thus will have a larger chemical reaction with baking soda.

When sea ice melts, there will be a significant amount of sea level rise.
O True
O False

Answers

It will be true, since the ice bergas that fall off can be as big as a 98-164 feet. Form what I have resched

It is False. Because the volume of water they displace as ice is the same as the volume of water they add to the ocean when they melt. So the sea level does not rise when sea ice melts.

why do humans have good memory

Answers

Humans have good memory because of their brain, one part of the human brain has a function just for memory!

When the ocean absorbs CO2 it leads to what?

Answers

Explanation:

Each liquid falls somewhere along a scale with acid at one end and alkaline at the other. Normally, ocean water is less acidic than fresh water. Unfortunately, as the ocean absorbs more and more carbon dioxide from the atmosphere, it becomes more acidic. Lemon juice is an example of an acidic liquid.

Answer:

If the ocean absorbs a lot of CO2 it is most likely to become acidic

what does arrows mean in science

Answers

It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant
Other Questions
Do you think two students who made no computation errors would get different values for this numerical expression> explain (4x35)+(36x8 find the measure of x in the figure. show your work. answer asap please Help!!!! I need the answer to this Resumen cap 17 de Marianela doy 15puntos FIRST ONE TO ANSWER CORRECTLY GETS A KISS ^^ y=-9x^2+571x-3884 find x a concerto______ is a type of concerto for a group of soloists rather than just one Before WWII started weremost European countriescommunist or democratic? List as many recreational drugs as you can think of What external conflict does Portia want Brutus to reveal to her? A wire carries a current of 6.52 A in a direction that makes an angle of 44.8 degrees with the direction of a magnetic field of strength 0.258 T. What is the magnetic force on a 3.61 m length of wire hello shawty's, shawto's and shawt'eths When factoring the difference of two squares, what will the signs in the parenthesis be Terry rents a kayak while he is on vacation. He is required to pay a deposit of $95 plus an additional $11.50 per day. Terry only has $150 to spend on kayaking. Write and solve an inequality you can use to determine the maximum number of days Terry can afford to rent a kayak. explain the errors in each error in spreadsheet and how to correct each how do you change a fraction to a unit rate 1. Fill in the blanks:a. We stood____the tree during scorching sunlight. (below/under/by)b. A woman struck____me and nearly fell. (against/at/with)c. Are you____this photograph?(on/at/in)d. Don't tease____the poor. (in/at/on)e. He writes____a pen. (with/by/for)f. He spoke____me.(in/on/at)g. I have never heard____David.(of/about/with)h. There is a label____the bottle. (on/over/in)i. I am new____this position. (for/to/of)j. Wisdom is the gift____heaven.(from/of/by)k. She is a girl____twenty.(at/of/by)l. The bullet whistled____her friend's ear. (past/from/through)m. I bought this pant____Rs. 300.(in/at/for)n. Rabin is pleased____his performance in New York. (with/from/by) MFK Corp. wants to raise capital and is considering an offer of bonds and debentures. It is not sure of a particular disclosure requirement, so MFK poses its question to the SEC and requests an interpretation letter. If the SEC issues an interpretive letter addressing MFK's question and MFK follows the statements contained in the letter, MFK cannot be penalized should the advice be incorrect.a. Trueb. False Solve w = x + for y.Reply really fast and give like the work for it too please Someone help me with this pls