The image below compares a normal DNA
sequence and one mutated to produce sickle
cell. Describe how the DNA strand has
been mutated and examine the amino
acid sequence. Is this a frameshift
mutation? How do you know?
Hemoglobin DNA strand
ATGGTGCACCIGACTCCTGAGGAGAAG
amino acid sequence (val his leu thr pro glu glu
Sickle cell hemoglobin DNA strand
ATGGTGCACCTGACTCCTGTGGAGAAG
amino acid sequence val his leu thr pro val glu

Answers

Answer 1

The image is unattached. A DNA strand can be mutated through various mechanisms, such as exposure to ultraviolet light, radiation, and certain chemicals, or spontaneous errors during DNA replication.

How is the DNA strand mutated?

These mutations can take the form of base substitutions, insertions, or deletions, and may affect a single nucleotide or a larger segment of DNA.

Amino acid sequences are determined by the sequence of nucleotides in a DNA strand. In the process of transcription, DNA is copied into RNA, and during translation, the RNA is read by ribosomes and translated into a sequence of amino acids, forming a protein. Each set of three nucleotides, called a codon, corresponds to a specific amino acid. If a mutation occurs in a DNA strand, it may alter the sequence of codons, which in turn could lead to a change in the amino acid sequence of the resulting protein.

To examine the amino acid sequence, the mutated DNA sequence must first be transcribed into RNA, and then translated into a protein. The resulting amino acid sequence can be analyzed and compared to the original, non-mutated sequence to determine the effects of the mutation.

Read more on DNA strand here:https://brainly.com/question/29037480

#SPJ1


Related Questions

How is childbirth an example
of a positive feedback
mechanism? A. A chemical is released at fertilization that stimulates the growth of the fetus. B. The fluid in the placenta begins to be filtered out to the baby falls lower. C. The fetus of a human grows and as it grows a larger the uterus of the mother grows larger. D. The release of oxytocin leads to increased contractions which produces more oxytocin.

Answers

Based on what I know I believe it’s D

what are the folds in mitochondrial membranes called? multiple choice matrix rugae lumen cristae villi

Answers

The folds in mitochondrial membranes are called cristae.

Mitochondria are known as the powerhouse of cells since they produce most of the ATP molecules that cells utilize as a source of energy. Mitochondria are characterized by their double membrane structure, with the inner membrane consisting of numerous folds known as cristae. These folds increase the membrane's surface area, allowing for a greater amount of ATP to be synthesized by the mitochondria.

In addition, the inner mitochondrial membrane is more permeable than the outer mitochondrial membrane, enabling the transfer of protons across the membrane during cellular respiration. This procedure produces a proton gradient that is utilized to produce ATP through a process known as oxidative phosphorylation.

Therefore, cristae are significant components of the mitochondrial membranes because they play a role in the generation of ATP molecules by increasing the surface area of the inner mitochondrial membrane.

Learn more about mitochondrial membranes:

https://brainly.com/question/29639877

#SPJ11

describe the structure of an actin myofilament including the actin proteins, troponin, and tropomyosin

Answers

The structure of an actin myofilament includes actin proteins, troponin, and tropomyosin. These elements all play an essential role in the contraction of muscles.

The actin myofilament is composed of many actin proteins, which are twisted together to form a thin filament. This filament is then wrapped in a sheet of tropomyosin, which helps to regulate the myofilament's ability to contract. The tropomyosin is also responsible for interacting with the troponin protein. The troponin protein is responsible for regulating the interaction between actin and myosin, which is the fundamental mechanism of muscle contraction. It does this by binding to both tropomyosin and actin. This interaction alters the tropomyosin's position, allowing myosin to bind to actin and generate muscle contractions. So, this is how actin myofilament works in our body.

Learn more about actin: https://brainly.com/question/23185374

#SPJ11

organisms that are classified as consumers capture their energy directly from the sun. group of answer choices true false

Answers

The statement "organisms that are classified as consumers capture their energy directly from the sun" is  False. Consumers are organisms that cannot produce their own food and must obtain energy from other sources.

Consumers capture energy from the sun indirectly, by consuming organisms (like plants or other animals) that have already captured the energy from the sun.

Plants, for example, capture energy from the sun through photosynthesis and use it to produce glucose. This glucose is then passed up the food chain to the consumer. Consumers obtain their energy from the organisms they consume, not directly from the sun.

To know more about Consumers refer to-

https://brainly.com/question/15869639#

#SPJ11

where would you expect to find tight junctions? where would you expect to find tight junctions? between the smooth er and the rough er in the epithelium of an animal's stomach between plant cells in a woody plant in the plasma membrane of prokaryotic cells

Answers

Tight junctions are found in the epithelium of an animal's stomach and between the smooth ER and the rough ER in cells.

Tight junctions are most commonly found between the smooth ER and the rough ER, as well as in the epithelium of an animal's stomach. Tight junctions are one of three types of cell junctions, with the other two being desmosomes and gap junctions. Tight junctions form a barrier that limits the passage of substances between cells in tissues that need to be tightly regulated, such as the gastrointestinal tract, blood-brain barrier, and kidney tubules. They seal the space between adjacent cells by forming a continuous belt-like structure around the circumference of each cell. Tight junctions are made up of transmembrane proteins called claudins, occludins, and junctional adhesion molecules (JAMs), which interact with cytoplasmic scaffold proteins such as zonula occludens (ZO) to create a tight seal.

To learn more about Epithelium :

https://brainly.com/question/7446006

#SPJ11

when a salmon moves from the freshwater to an ocean environment, you would expect its urine volume to

Answers

When a salmon moves from the freshwater to an ocean environment, you would expect its urine volume to decrease.

As salmon migrate from freshwater to the ocean, the osmolarity of the environment that they live in changes significantly. Osmolarity refers to the number of particles that are present in a solution and how they affect water movement across membranes.

In freshwater, the osmolarity is generally lower than that of the fish's body fluids. As a result, water enters the fish's body through osmosis, and excess water is removed from the body via urine.

In comparison, the osmolarity of seawater is much greater than that of a fish's body fluids. As a result, water moves out of the fish's body through osmosis, which can lead to dehydration. To avoid dehydration in the ocean, the fish must excrete less water.

So, when a salmon moves from freshwater to an ocean environment, you would expect its urine volume to decrease.

To know more about Osmolarity, refer here:

https://brainly.com/question/28161922#

#SPJ11

what does this help explain about genetics. and the change occur in a species over time?

Answers

Evolution helps explain how genetic variation arises and how it is passed on from one generation to the next.

How do organisms evolve overtime?

As organisms reproduce, mutations and genetic recombination can introduce new genetic variations into a population. Over time, natural selection and other evolutionary forces can act on these variations, leading to changes in the frequency of certain traits within a population.

Evolution also helps to explain how species change over time. As populations accumulate genetic variations and adapt to different environmental conditions, they may become distinct from their ancestors and other related species. This process of speciation can ultimately result in the formation of new species.

Learn more on evolution here: https://brainly.com/question/4207376

#SPJ1

The complete question is:

Evolution is the process by which populations of organisms change over generations. What does this help explain about genetics. and the change occur in a species over time?

what is at least one feature that differentiates a humerus from a femur, at both the proximal and distal ends?

Answers

At least one feature that differentiates a humerus from a femur, at both the proximal and distal ends is: Proximal: The humerus features a round head, which is much larger than the neck, whereas the femur has a much larger head than the neck.

Distal: The humerus features a prominent lateral epicondyle and medial epicondyle, which are the sites of muscle attachments, whereas the femur features a lateral and medial condyle, which articulate with the tibia during the knee joint movement.

The humerus and the femur are two of the body's longest and strongest bones, forming the limbs' upper and lower sections. Both of these bones have an epiphysis at each end, which connects to other bones via ligaments and enables the bones to rotate around their joints.

The differences between the humerus and the femur are as follows:

Proximal: The humerus features a round head, which is much larger than the neck, whereas the femur has a much larger head than the neck. The humerus has two bony projections: the greater tubercle and the lesser tubercle, whereas the femur has two bony projections: the greater and lesser trochanter. The humerus has a shallow glenoid fossa, which is where the head of the radius fits in, whereas the femur has a deep acetabulum that articulates with the pelvis' head.

Distal: The humerus features a prominent lateral epicondyle and medial epicondyle, which are the sites of muscle attachments, whereas the femur features a lateral and medial condyle, which articulate with the tibia during the knee joint movement.

Here you can learn more about humerus

https://brainly.com/question/28837867#

#SPJ11  

PLEASE HELP AND FAST
Heredity Lab Report
Instructions: In the Heredity lab, you investigated how hamsters inherit traits from their parents. Record your observations in the lab report below. You will submit your completed report.

Name and Title:
Include your name, instructor's name, date, and name of lab.


Objective(s):
In your own words, what was the purpose of this lab?


Hypothesis:
In this section, please include the if/then statements you developed during your lab activity. These statements reflect your predicted outcomes for the experiment.

Test One: If I breed a short fur, FF female with a short fur, Ff male, then I will expect to see (all short fur; some short and some long fur; all long fur) offspring.

Test Two: If I breed a short fur, Ff female with a short fur, Ff male, then I will expect to see (all short fur; some short and some long fur; all long fur) offspring.

Test Three: If I breed a long fur, ff female with a long fur, ff male, then I will expect to see (all short fur; some short and some long fur; all long fur) offspring.


Procedure:
The procedures are listed in your virtual lab. You do not need to repeat them here. Please be sure to identify the test variable (independent variable) and the outcome variable (dependent variable) for this investigation.

Remember, the test variable is what is changing in this investigation. The outcome variable is what you are measuring in this investigation.

Test variable (independent variable):
Outcome variable (dependent variable):


Data:
Record the data from each trial in the data chart below. Be sure to fill in the chart completely.

Test One

Parent 1: FF

Parent 2: Ff


Phenotype ratio:
________ :

________
short fur :

long fur

Test Two

Parent 1: Ff

Parent 2: Ff


Phenotype ratio:
________ :

________
short fur :

long fur

Test Three

Parent 1: ff

Parent 2: ff


Phenotype ratio:
________ :

________
short fur :

long fur

Conclusion:
Your conclusion will include a summary of the lab results and an interpretation of the results. Please write in complete sentences.

Which genotype(s) and phenotype for fur length are dominant?
Which genotype(s) and phenotype for fur length are recessive?
If you have a hamster with short fur, what possible genotypes could the hamster have?
If you have a hamster with long fur, what possible genotypes could the hamster have?
Did your data support your hypotheses? Use evidence to support your answer for each test.
Test One:
Test Two:
Test Three:
Which hamsters are the parents of the mystery hamster? Include evidence to prove that they are the correct parents.

Answers

The parents of the mystery hamster are most likely Test Two parents (Ff x Ff), as they have the possibility of producing both short fur and long fur offspring, which matches the observed phenotype of the mystery hamster.

What is Genotype?

The genotype of an organism can be represented using letters to denote the alleles inherited from each parent. For example, in humans, the gene for eye color has two alleles: brown (B) and blue (b). A person with brown eyes would have a BB or Bb genotype, while a person with blue eyes would have a bb genotype.

Test variable (independent variable): Genotype of parents

Outcome variable (dependent variable): Phenotype of offspring (fur length)

Data:

Test One

Parent 1: FF

Parent 2: Ff

Phenotype ratio:

3 : 0

short fur : long fur

Test Two

Parent 1: Ff

Parent 2: Ff

Phenotype ratio:

3 : 1

short fur : long fur

Test Three

Parent 1: ff

Parent 2: ff

Phenotype ratio:

0 : 4

short fur : long fur

From the lab results, we can conclude that the genotype for short fur length is dominant over the genotype for long fur length. The genotype for long fur length is recessive.

If you have a hamster with short fur, the possible genotypes could be FF or Ff.

If you have a hamster with long fur, the genotype could only be ff.

The data supports the hypothesis that the genotype for short fur is dominant and the genotype for long fur is recessive.

Learn more about Genotype from the given link

https://brainly.com/question/22117

#SPJ1

modes of natural selection 0.2 points/question 1. which type of selection tends to increase genetic variation?

Answers

Disruptive selection tends to increase genetic variation by selecting against intermediate phenotypes.

Natural selection is a process by which organisms with traits that are advantageous for their environment survive and reproduce more frequently than those with less favorable traits. Natural selection occurs through different modes or types, including stabilizing selection, directional selection, and disruptive selection.

Stabilizing selection is a mode of natural selection that favors the mean or average phenotype in a population. This mode tends to reduce genetic variation by selecting against extreme or uncommon phenotypes. This type of selection occurs in stable environments where extreme phenotypes are not favorable.

Directional selection, on the other hand, is a mode of natural selection that favors individuals with phenotypes at one extreme of the distribution. This mode of selection tends to increase or decrease the frequency of a trait in a population, leading to a shift in the mean phenotype towards the favored extreme. This mode may occur in changing environments where the selection pressure favors one extreme phenotype.

Disruptive selection is a mode of natural selection that favors individuals with phenotypes at both extremes of the distribution. This mode tends to increase genetic variation by selecting against intermediate phenotypes. This mode may occur in environments where there are different niches or habitats that favor different phenotypes.

Here you can learn more about Disruptive selection

https://brainly.com/question/31157024#

#SPJ11

the organ dysfunction that has increased pressure in the abdominal cavity due to ischemia of abdominal tissues is called:

Answers

Answer: ACS

Explanation:

Abdominal compartment syndrome

The organ dysfunction that has increased pressure in the abdominal cavity due to ischemia of abdominal tissues is called 'Ischemic Intestinal Dysfunction' (IID).

IID is a serious complication of intestinal ischemia, which occurs when the intestinal tissues are deprived of oxygen and nutrients. This can happen as a result of reduced blood supply to the intestines, blocked blood vessels, or reduced absorption of nutrients from the intestine.

Symptoms of IID include nausea, abdominal pain, fever, and vomiting. In severe cases, IID can lead to sepsis and organ failure.

Treatment of IID typically involves restoring blood flow to the intestines, either with drugs or surgery. The treatment plan will depend on the severity of the case and the underlying cause. Medical professionals may also use antibiotics, antifungals, and other drugs to treat any infection and reduce the risk of complications.

In addition to medical treatment, the patient may need to change their lifestyle and diet to prevent further damage to the intestine. Patients should avoid activities that increase their risk of abdominal pressure, such as vigorous exercise, and ensure they are consuming a nutritious diet with plenty of fiber and fluids.

IID is a serious condition that requires prompt diagnosis and treatment. With the right care and attention, most patients can make a full recovery.

To know more about Ischemic Intestinal Dysfunction' (IID) refer to-

https://brainly.com/question/14298105#

#SPJ11

cells of pancreas produce a lot of secretory protein insullin. these cells will have large amount of what?

Answers

The cells of the pancreas that produce a lot of secretory protein insulin will have a large amount of rough endoplasmic reticulum.

What is rough endoplasmic reticulum?

The rough endoplasmic reticulum (RER) is an organelle in eukaryotic cells that is responsible for producing proteins. It is distinguished by the presence of ribosomes on its surface, which gives it a rough appearance. The RER synthesizes proteins, which are then processed and delivered to the correct location.

The RER synthesizes membrane-bound and secretory proteins, which are then transported to other organelles or secreted from the cell. The rough endoplasmic reticulum's ribosomes are an important factor in protein synthesis because they aid in the translation of messenger RNA into amino acids, which are then assembled into proteins. Since the cells of the pancreas produce a lot of secretory protein insulin, they would require a lot of rough endoplasmic reticulum.

Here you can learn more about rough endoplasmic reticulum

https://brainly.com/question/13118914#

#SPJ11  

the organism sllub adirolfhtuos has 16 pairs of long chromosomes, whereas the organism scub yabapmat has 20 pairs of short chromosomes. the expected chromosome number in somatic tissues of a hybrid between these two organisms is

Answers

Whereas Scub yabapmat has 20 pairs of short chromosomes, the creature Sllub adirolfhtuos has 16 pairs of long chromosomes. In the somatic tissues of a hybrid between these two creatures, 36 chromosomes are anticipated.

Amoeba cherish has 500 chromosomes, whereas Ascaris megalocephaly only has two in each nucleus, making it the organism with the fewest chromosomes. There are 46 chromosomes in all, divided into 23 pairs, in humans.

Indeed, there are a certain number of chromosomes for each species of plants and animals. For instance, a fruit fly has four pairs of chromosomes whereas a dog has 39 and a rice plant has 12. For instance, both potatoes and chimpanzees contain 24 pairs of chromosomes.

Learn more about chromosomes Visit: brainly.com/question/11912112

#SPJ4

clouded leopards are a medium sized, endangered species of cat, living in the very wet cloud forests of central america. the trait for spot color is carried on the x chromosome. is this an example of sex-linked inheritance? why or why not?

Answers

Despite being more closely related to big cats, the clouded leopard is frequently referred to as a hybrid because of its diminutive size. It has a long tail and proportionately short legs.

Brown or yellowish-gray in color, the coat is covered in irregular dark stripes, spots, and blotches. Obfuscated panthers are medium estimated, imperiled types of living in the extremely wet cloud woodlands of Focal America Accept that the light spots (XH are dominant_ sex-connected characteristics and that dull spots are the latent partner.

Clouded leopards are well-suited for living in trees. They excel in the trees due to their sharp, retractable claws, large feet, and short, flexible legs. As they leap from branch to branch, their long tail helps them stay in balance.

To learn more about clouded leopards here

https://brainly.com/question/27428495

#SPJ4

dicyclohexylcarbodiimide (dccd) reacts with asp and glu residues in the c subunits of f0 and blocks atp synthase activity. what happens to the rate of electron transport when dccd is added to actively respiring mitochondria?

Answers

Dicyclohexylcarbodiimide (DCCD) reacts with Asp and Glu residues in the c subunits of F0 and blocks ATP synthase activity. The rate of electron transport when DCCD is added to actively respiring mitochondria is decreased.

The Dicyclohexylcarbodiimide (DCCD) inhibits mitochondrial ATPase by covalently binding to a carboxyl residue. It reacts with the Asp and Glu residues present in the c subunits of F0, and as a result, ATP synthase activity is blocked. Mitochondrial ATPase (F1F0) is an enzyme that synthesizes ATP using energy from the electrochemical proton gradient that is generated by the electron transport chain during oxidative phosphorylation.In the absence of ATP synthase activity, the proton gradient generated by electron transport can not be used to generate ATP.

As a result, less ATP is synthesized by actively respiring mitochondria. The rate of electron transport decreases as a result of this. This reaction also inhibits the ATPase activity of other complexes involved in electron transport. As a result, it decreases the rate of electron transport and ATP synthesis in respiring mitochondria.DCCD reacts with Asp and Glu residues in the c subunits of F0 and blocks ATP synthase activity. The effect of adding DCCD to actively respiring mitochondria is that the rate of electron transport is decreased.

Learn more about mitochondria at:

https://brainly.com/question/29763308

#SPJ11

1. Why do Peru and Africa have different amounts of copper deposits?

Answers

Peru and Africa have different amounts of copper deposits due to differences in geologic history and tectonic activity.

The Andes Mountains, which run through Peru, were formed by the collision of the South American and Nazca tectonic plates. This collision caused the Earth's crust to buckle and fold, creating the conditions for the formation of large copper deposits. In contrast, Africa's copper deposits were formed through a variety of processes, including sedimentary and hydrothermal processes.

Additionally, the African continent has undergone multiple tectonic events throughout its history, which have impacted the distribution and formation of copper deposits. Other factors, such as climate and erosion, can also play a role in the distribution of copper deposits. Therefore, the geologic history and tectonic activity of a region are important factors in determining the amount and location of copper deposits.

To learn more about copper deposits, here

https://brainly.com/question/22909479

#SPJ4

what is the gene density of the human genome? calculate your answer in genes per mb (mega base pairs, or 1 million base pairs).

Answers

The C. elegans roundworm genome is thought to have 200 genes, whereas the human genome has 11–15 genes per Mb.

Around 3.0 billion base pair human genome to Mb conversion to determine gene density as genes per Mb (3,000). Then, divide the genome size in Mb by the 21,000 human genes. Human gene density, calculated as 21,000/3,000, is 7 genes per Mb.

The C. elegans roundworm genome is thought to have 200 genes, whereas the human genome has 11–15 genes per Mb. Simple species with a lot less genetic complexity than humans include bacteria and amoebas. The gene density in bacterial DNA ranges from 500 to 1000 genes per Mb.

To know more about Genome, visit,

https://brainly.com/question/17049285

#SPJ4

emerging viruses arise by * 5 points a) mutation of existing viruses. b) the spread of existing viruses to new host species. c) the spread of existing viruses more widely within their host species. d) all of the above

Answers

The emergence of new viruses can occur through a variety of mechanisms. Therefore, the correct answer is (d) all of the above.

What is emerging viruses ?

Emerging viruses are viruses that have recently appeared or are rapidly increasing in incidence or geographic range. These viruses are often new strains or variants of known viruses that have mutated or evolved to become more virulent, infectious.

Emerging viruses can pose significant public health threats, as they often have no known treatments or vaccines and can rapidly spread from person to person.

Therefore, the correct option is D

Learn more about emerging viruses here : brainly.com/question/17173059

#SPJ1

explain the different patterns that you see in the phylogenetic tree. look at their body shape, habitat, and the island on which they are found. write down as many observations as you can.

Answers

Phylogenetic trees can reveal patterns in the evolution of species based on their body shape, habitat, and location. Here are some observations you can make when studying a phylogenetic tree:

Different species tend to have different body shapes, indicating different evolutionary trajectories.Species located on different islands often share a common ancestor, which can be determined by looking at the tree structure.Species living in similar habitats may be related and can often be distinguished from other species by examining the tree.

These are just a few of the patterns that can be observed when looking at phylogenetic trees. By studying the tree structure, we can gain valuable insight into how species evolved over time.

Here you can learn more about Phylogenetic trees

https://brainly.com/question/30820701#

#SPJ11  

what kind of environment does wild rice grow best in?

Answers

Wild rice grows best in lakes streams and rivers. They prefer shallow water with a slow current as well as muddy substrate.

do human eggs only have an X chromosome

Answers

Answer:

Yes, human eggs (also known as ova or female gametes) only have an X chromosome. This is because human females have two X chromosomes in their cells, and during meiosis, when the egg is formed, one of the X chromosomes pairs up and separates, leaving only one X chromosome in the mature egg cell. In contrast, human sperm can have either an X or a Y chromosome, as males have one X and one Y chromosome in their cells.

Classify each interaction as mutualism, commensalism, or parasitism. Explain your answers.

A remora fish attaches itself to the underside of a shark without harming the shark, and eats leftover bits of food from the shark's meals.

A vampire bat drinks the blood of horses.

A bee collects pollen and pollinates a flower.

Answers

The remora fish that frequently swim alongside the leopards shark and yet are bonded to its body exhibit mutualism. The Remora hangs out beneath the shark's belly & scavenges extra food that it has left behind.

What roles do blood cells play in the body?

The primary function for red blood cells, and erythrocytes, is to transport carbon dioxide, a waste product, from the tissues back to the lungs and deliver oxygen from the lung to the body's tissues.

What occurs when red blood cell levels are low?

The body's capacity to move nutrients and oxygen throughout the cardiovascular system can be impacted by anemia, commonly known as a low RBC count. It may result in weakness, lightheadedness, and palpitations.

To know more about Blood visit:

https://brainly.com/question/14781793

#SPJ1

which of the following are true of asexual reproduction? choose all that apply. the offspring are genetically different than the parents. there is only one parent. the offspring are genetically identical to the parent. there are two parents.

Answers

Asexual reproduction is the process by which an organism reproduces by itself without requiring gamete cells from another organism. Asexual reproduction generates genetically identical offspring to the parent. Therefore, the correct answer to this question is: there is only one parent. the offspring are genetically identical to the parent.

Usually, in asexual reproduction, there is only one parent involved. This implies that there is no exchange of genetic information between two individuals. As a result, the offspring generated through asexual reproduction are genetically identical to the parent.

As a result, the genetic makeup of the parent is transferred to the offspring without alteration.In conclusion, asexual reproduction is a significant mode of reproduction among organisms that do not require the existence of the opposite sex to reproduce.

Asexual reproduction is advantageous in some ways since it does not necessitate locating a partner, and the offspring generated are often quick to mature and establish themselves in a new location.

For such more question on gamete cells:

https://brainly.com/question/7648924

#SPJ11

The following question may be like this:

Which of the following are true of asexual reproduction? choose all that apply.

the offspring are genetically different than the parents. there is only one parent. the offspring are genetically identical to the parent. there are two parents.

which of these characteristics would you expect to find in a member of the bilateria?
a. Segmentation
b. Coelom
c. Two tissue layers (diploblastic)
d. Specialized head region

Answers

One would expect to find the characteristic of specialized head region in a member of the Bilateria. Thus, option D is correct.

Bilateria is an animal clade with bilaterally symmetric animals. They are members of the Kingdom Animalia that are characterized by having bilateral symmetry during the embryonic development stage. The other characteristic options were:

A. Segmentation: It is a characteristic of Annelids, Arthropods, and Chordates. Segmentation refers to the division of the body into many parts, each with a separate function.

B. Coelom: It is a characteristic of many animal groups, such as Mollusca, Arthropods, and Vertebrates. It refers to a cavity that is completely surrounded by mesodermal tissue and is present in most animals.

C. Two tissue layers (diploblastic): This characteristic is found in Cnidarians and Ctenophores, which have two layers of cells, ectoderm and endoderm. These animals lack a body cavity, nervous system, and circulatory system.

D. Specialized head region: It is the characteristic of Bilaterians, which have a complex nervous system with a distinct head region. The centralization of the nervous system makes possible the evolution of highly complex neural circuits, enabling behavior that is more complex than that of diploblastic animals.

Hence, we can conclude that the characteristic of specialized head region would be expected to find in a member of the Bilateria.

Read more about "Bilateria"; https://brainly.com/question/22712460

#SPJ11

large attitudinal scales might result in what type of bias? large attitudinal scales might result in what type of bias? auspices fatigue extremity sampling halo

Answers

The correct option is E, Large attitudinal scales might result in Halo type of bias. The halo effect is a type of bias that can occur when large attitudinal scales are used.

This bias can occur when the respondent has a strong positive or negative attitude towards the subject matter, which can then influence their ratings on the scale.

The Halo effect is a cognitive bias that affects our perception of people, products, or brands. It occurs when we allow one positive attribute of someone or something to influence our overall impression and judgment of that entity. For example, if we perceive someone as physically attractive, we may also assume that they have other positive qualities, such as intelligence or kindness, even if we have no evidence to support those assumptions.

Similarly, if we like a certain brand or product, we may be more likely to overlook its flaws or negative aspects. The Halo effect can have both positive and negative consequences. On the one hand, it can lead us to form positive impressions of people or products based on a single positive attribute.

To learn more about Halo effect visit here:

brainly.com/question/14739328

#SPJ4

Complete Question: -

Large attitudinal scales might result in what type of bias?

a.Auspices

b.Fatigue

c.Extremity

d.Sampling

e.Halo

how does the respiratory center control the diaphragm? multiple choice via the blood carbon dioxide level

Answers

The respiratory center in the brainstem is responsible for controlling the diaphragm. It does this by monitoring the level of carbon dioxide in the blood, and then sending nerve signals to the diaphragm muscles to either contract or relax.

The respiratory center controls the diaphragm via the blood carbon dioxide level. When the carbon dioxide level increases in the blood, it will stimulate the respiratory center to make the diaphragm and other respiratory muscles contract.

The respiratory center is a group of cells that are found in the medulla oblongata part of the brainstem, which controls the process of respiration. The respiratory center receives input from other areas of the brain, peripheral chemoreceptors, and central chemoreceptors in response to changes in the level of oxygen, carbon dioxide, and pH in the blood.

The respiratory center is responsible for the regulation of the respiratory cycle. It initiates the inhalation and exhalation by controlling the activity of the diaphragm and other respiratory muscles. When the carbon dioxide level in the blood rises, it will stimulate the respiratory center to increase the rate and depth of breathing. This will result in the exhalation of more carbon dioxide and the intake of more oxygen from the atmosphere. Similarly, when the oxygen level in the blood decreases, the respiratory center will respond by increasing the rate of breathing to take in more oxygen.

Carbon dioxide plays a crucial role in the regulation of breathing. It is produced as a waste product during the process of cellular respiration in the body. If the carbon dioxide level in the blood becomes too high, it can cause respiratory acidosis, a condition in which the blood becomes too acidic. This can lead to a range of health problems, including fatigue, confusion, and even coma.

Therefore, the respiratory center is sensitive to changes in the level of carbon dioxide in the blood and responds by controlling the rate and depth of breathing to maintain the proper balance of oxygen and carbon dioxide in the body. When the level of carbon dioxide is high, the respiratory center sends signals to the diaphragm to contract, leading to an increased breathing rate.

For more such questions on respiratory center , Visit:

https://brainly.com/question/13146276

#SPJ11

The complete questions is

how does the respiratory center control the diaphragm?

Multiple Choice:
A) Carbon dioxide level
B) Oxygen level
C) Blood sugar level
D) Heart rate

what is the correct equation for cellular respiration showing the reactants on the left of the equal sign and products on the right of the equal sign?

Answers

The correct equation for cellular respiration showing the reactants on the left of the equal sign and products on the right of the equal sign is: C6H12O6 + 6O2 → 6CO2 + 6H2O + ATP.

Cellular respiration is a process that occurs in the cells of living organisms in order to release energy from food molecules (such as glucose). There are three main stages of cellular respiration: glycolysis, the Krebs cycle, and oxidative phosphorylation.

During these stages, glucose is broken down into carbon dioxide and water, and ATP (adenosine triphosphate) is produced as an energy source for the cell. The balanced equation for cellular respiration shows that glucose and oxygen react to produce carbon dioxide, water, and energy (in the form of ATP).

Learn more about Cellular respiration at https://brainly.com/question/14158795

#SPJ11

a mutation in the e. coli sigma70 protein results in a increased interaction or stability between sigma70 and rna polymerase. what is the most likely

Answers

The most likely mutation in the E. coli sigma70 protein that would result in an increased interaction or stability between sigma70 and RNA polymerase is a point mutation.

Point mutations are changes in single nucleotides within a gene, which can cause a change in the amino acid sequence of a protein, resulting in a different structure and different properties of the protein. In this case, the point mutation in sigma70 could result in increased interaction or stability with RNA polymerase.

A mutation in the E. coli sigma70 protein results in an increased interaction or stability between sigma70 and RNA polymerase. The most likely explanation for this is that the mutation has increased the affinity of sigma70 for RNA polymerase.

Read more about mutation:

https://brainly.com/question/17031191

#SPJ11

the reverse of the reaction carried out by pyruvate kinase in glycolysis is carried out by which enzyme(s) in gluconeogenesis? pyruvate carboxylase fructose 1,6-bisphosphatase phosphoenolpyruvate carboxykinase both pyruvate carboxylase and phosphoenolpyruvate carboxykinase

Answers

The reverse of the reaction carried out by pyruvate kinase in glycolysis in gluconeogenesis is carried out by both pyruvate carboxylase and phosphoenolpyruvate carboxykinase in gluconeogenesis.

Pyruvate kinase is an enzyme that catalyzes the conversion of phosphoenolpyruvate (PEP) to pyruvate, with the production of adenosine triphosphate (ATP). In gluconeogenesis, pyruvate carboxylase catalyzes the conversion of pyruvate to oxaloacetate, a reaction that is the opposite of the reaction catalyzed by pyruvate kinase in glycolysis. In addition, phosphoenolpyruvate carboxykinase (PEPCK) is involved in the conversion of oxaloacetate to phosphoenolpyruvate (PEP), with the production of guanosine triphosphate (GTP). Both of these reactions are the reverse of the reaction catalyzed by pyruvate kinase in glycolysis.

Pyruvate carboxylase and phosphoenolpyruvate carboxykinase play an important role in the conversion of energy from pyruvate to oxaloacetate and phosphoenolpyruvate, respectively. These reactions are essential for the production of energy during gluconeogenesis. In addition, fructose 1,6-bisphosphatase is also involved in gluconeogenesis, catalyzing the hydrolysis of fructose 1,6-bisphosphate to form fructose 6-phosphate and inorganic phosphate.

In summary, the reverse of the reaction catalyzed by pyruvate kinase in glycolysis is catalyzed by both pyruvate carboxylase and phosphoenolpyruvate carboxykinase in gluconeogenesis, and is also assisted by fructose 1,6-bisphosphatase. These enzymes are essential for the production of energy in gluconeogenesis.

Learn more about pyruvate carboxylase at:

https://brainly.com/question/30770275?

#SPJ11

compared to previous hominin species, members of the homo genus ate more group of answer choices seeds. leaves. plants. meat.

Answers

The correct answer is (d), Compared to previous hominin species, members of the Homo genus ate more meat.

Various species in the Homo genus, including Homo habilis, Homo erectus, and Homo sapiens, are believed to have included meat in their diets, according to scientific evidence.

A rise in the consumption of meat was a significant turning point in the evolution of humans from the early primates that are believed to have existed millions of years ago.

Meat consumption played a significant role in human evolution, especially in the development of larger brain size. Meat is abundant in the energy, protein, and fat that are necessary for a larger brain, so humans that consumed meat may have had an evolutionary advantage over those that didn't.

Larger brains were then associated with the development of complex cognitive processes, including language and advanced problem-solving skills, which are crucial to our existence as a species.

Hominins are a group of primates that existed in the Pleistocene era and whose members are believed to have evolved into modern humans. Hominins include extinct species such as Australopithecus, Paranthropus, and Homo.

To know more about Homo genus, refer here:

https://brainly.com/question/30673067#

#SPJ4

Other Questions
What is a chromosome? the earth's lowest barometric pressures are associated with hurricanes (typhoons). frontal systems (cold and warm fronts). sea level. cold and dry climates. very cold temperatures. PLEASE HELP FAST!!!!!!!!!!!!!!!!What was Vietnams economic struggle after the war ended?A.)creating private businesses so residents could earn wages to stimulate the economyB.)reverting factories back to producing and selling military goodsC.)recovering destroyed farms and cities under a new communist economyD.)ending a period of isolation to open communication with other nations for trade HIJ is similar to STR. What is the perimeter of STR? 5 cards are drawn randomly from a regular deck of cards. how many ways can you draw 5 cards and get 4 hearts and 1 spade? the share price of firm that cuts its dividend in order to invest in a new project that has a return blank the firm's market capitalization rate would be expecte the nutrition analysis of your favorite fast food meal indicated it contained 20 grams of fat! how many calories are provided by the fat? miguel went to a movie theater and bought a large bag of popcorn that cost $10.49. to avoid spending too much money in all, he determined that he could spend up to $5.51 on a drink. let x represent how much money miguel wanted to spend in all. which inequality describes the problem? you recently sold 300 shares of apple stock to another investor, and the transfer was made through a broker. this is an example of:] the nurse is working with a child who is in sickle cell crisis. treatment and nursing care for this child include which actions? select all that apply. the lowest surface air pressures ever recorded are associated with question 64 options: frontal systems (cold and warm fronts). hurricanes (typhoons). cold and dry climates. sea level. what did apple have to do when its apple maps product turned out to be utterly deficient in features and functionality? which word pair represents the closest cohort competitors of the word sandwich? group of answer choices sumo, sushi song, seal sandy, sandal an irrigation system waters a circular field that has a 30-foot radius. find the exact area watered by the irrigation system . when a client company decides to engage an external contractor to perform project work, it must be prepared to submit a proposal and prepare a bid. a. true b. false what types of sources are available through the jerry falwell library? how can you use the library to locate sources for your inquiry project? Match these items with their appropriate test.1. earth viewed from space minerals2. commanded first ship to sail around earth core 3. 7,900 miles mantle 4. hills, valleys, rivers, plains Magellan 5. layer below crust diameter at poles 6. at earth's center landforms 7. about 3,000 types a large sphere 3/ Describe the function of the washing machine? Write its types and explaio them. A "Blind Justice"because where I come fromjail or deathwere the two options she handed to usbecause where he came fromthe American Dreamwas the one option she handed to themSo here we are, blind Lady JusticeI see you, too"- Ibi Zoboi, Punching the Air/ Pg-44 What role does the Monroe Doctrine play in the War on Terror?