The process that allows molecules to move through a protein channel from an area of high concentration to low concentration.
A. Active Transport
B. Simple Diffusion
C. Osmosis
D. Facilitated Diffusion
Answer: D. Facilitated Diffusion
Explanation: Two classes of proteins that mediate facilitated diffusion are generally distinguished: carrier proteins and channel proteins.
describe how red blood cells are adapted for their function (2 marks)
The adaptations of red blood cells are no nucleus to accommodate more hemoglobin, biconcave shape to be able to pass through extremely small blood vessels, thin cell membrane to let oxygen diffuse faster, and presence of hemoglobin itself, that combines with oxygen to give off its red color.
According to the theory of endosymbiosis, a mitochondria or chloroplast may have been a prey species and was engulfed by a cell or it could have been a parasite that entered the cell. WHY do scientists think that the cell did not destroy or remove these structures?
A: because they competed with the cell
B: because the structures benefited the cell
Answer:
Because the structures benefited the cell
Explanation:
Scientists believe that host cells and bacteria formed a mutually beneficial endosymbiotic relationship when the host cells ingested aerobic bacteria and cyanobacteria but did not destroy them.
During what phase of the cell cycle do chromosomes replicate?
The phase of the cell cycle in which chromosomes replicate is the S phase.
What is Cell cycle?This is referred to as the series of events that take place in a cell during the process of reproduction an d in this scenario , the parent cells divide which gives rise to two daughter cells. Chromosome on the other hand is a thread like structure which is made up of DNA.
The S phase occurs between G₁ phase and G₂ phase and is an important process in mitosis as the DNA in the nucleus are synthesized and the traits present are usually passed to the offspring.
Read more about Cell division here https://brainly.com/question/796780
#SPJ1
found more than 400 different mutations in the PAH enzyme that are associated with PKU disease. how many alleles can be found in one individual?
you can only have 2 alleles per gene
When a trait has three or more distinct alleles, we refer to it as having multiple alleles inheritance. The human ABO blood type alleles/trait is an example of a trait with multiple alleles.
What analogy is used to describe how cell replication is regulated?
Driving a car might be one common analogy used to describe how cell replication is regulated.
What is the cell replication cycle?The cell replication cycle is a sharply regulated process that resembles driving a car because there are many steps that can be stopped to continue with the process.
In the case of the cell cycle, there are major points of control that regulate the progression through this process which involve the Growth 1 phase (G1), the synthesis S phase and the Growth 2 (G2) phase. All these phases in the cell cycle are regulated by the presence of cyclin proteins that are phosphorylated by cyclin-dependent kinases in order to continue with the cell cycle.
Therefore, with this data, we can see that the cell cycle is a sharply regulated process that has several points of control where the cell recognizes that all is fine to continue with the process.
Learn more about the cell cycle here:
https://brainly.com/question/5034994
#SPJ1
Given the structure of protein, why is the energy that is released as heat during chemical reactions not useable for work in biological systems?
Energy exists in different forms, some of which are electrical, heating, chemical, luminous, among others.
Chemical energy in biological systems is based on the formation-breaking of bonds: to form a bond, energy must be expended, while when a bond is broken, energy is released.
Often, these processes require the participation of enzymes within the organisms; enzymes are proteins that decrease the activation energy of a reaction. For example, if a lot of energy is needed to break a bond, the enzyme will help to lower the energy required.
In biological systems such as humans, the energy molecule is ATP, which releases energy when a bond is broken and a phosphate group is released, leaving ADP as a product. And although it is an efficient process, the laws of thermodynamics explain that no process is 100% efficient, and therefore, some amount of energy is always released in the form of heat. Unlike chemical energy, heat energy is not stored in bonds and cannot be catalyzed by enzymes or utilized by biological systems.
I’m am unsure of the steps to solve this and what to get for the answer
Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.
Mutation 1
5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'
Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.
3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'
Same sequence but from 5' - 3':
5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'
Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:
Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys
It should be noted that each chain will give rise to different amino acid sequences.
What Philosophy (Eastern or Western) do you believe defines you as a Filipino? Why?
Philosophy and religion in the Philippines are practically Christian, so the philosophy that defines you Filipo is Western.
What is Philippines?The Republic of the Philippines (Republika ng Pilipinas, in Filipino; Republic of the Philippines, in English) is an independent country located in Southeast Asia, whose capital is Manila. Its total area is around 300,000 km², slightly larger than the state of São Paulo. The country's population is about 93.6 million, mostly followers of Christianity, of the Catholic branch, with an important minority following Islam. The official languages are Filipino and English, and the currency is the Philippine Peso. The Philippines is an archipelago of 7107 islands located between Malaysia, Indonesia, Taiwan and China.
Learn more about Philippines in brainly.com/question/26599508
#SPJ1
Lamin A is a signaling protein embedded in the cell membrane. The locus of the lamin A gene is 1q22. On which human chromosome, arm, and position can the recipe for this protein be found?
Generally , these proteins are located in the nuclear lamina.
What is Lamin A ?
Instructions for creating a number of slightly different proteins known as lamins are provided by the LMNA gene. Most of the cells in the body make lamin A and lamin C, the two main proteins produced by this gene. These proteins are constructed from a pattern of virtually identical protein building units (amino acids). Lamin A is longer than lamin C due to the minute variation in the sequence.
These proteins are specifically found in the nuclear lamina, a layer of intermediate filaments and other proteins that is connected to the nuclear envelope's inner membrane. The nuclear envelope controls how molecules enter and exit the nucleus.
Learn more about nuclear lamina from given link
https://brainly.com/question/14986847
#SPJ13
Wind flows from an area of high air
pressure (more air) to an area of low
air pressure (less air). Why does wind
do this? What process is this an
example of?
Answer:
a
Explanation:
Are fungi autotrophs or heterotrophs? Explain your answer using scientific reasoning and data
Answer:
Yeasts, molds, and are all different kinds of fungi. Fungi are heterotrophs, meaning they obtain food from outside themselves. Common fungi include yeasts, molds, and mushrooms.
Hope this helps!
Don't forget to mark me as Brainlist.
when have you used skills of observation, experimentation, modeling? Describe and example of how you have used this skill
Observation is the act of carefully watching something over time.
Experimentation Scientists may perform experiments in the lab or in the field. lab experiment gives the researcher more control, the artificial setting does not reflect the complex interactions that occur in nature.
Field experiment, on the other hand, gives a more accurate picture of how organisms interact in a natural setting.
Modeling scientists use computer and mathematical models to describe and model nature. example, It is possible for some people to learn and adapt to completely new computer systems at work, while others have adjusted to the challenges of working remotely.
To learn more about Experimentation , here
brainly.com/question/14632229
#SPJ1
Which action would most likely lead scientists to change or improve an existing scientific theory about evolution?
Answer: Gathering new evidence using new technologies or procedures most likely will lead scientists to change or improve an existing scientific theory (Option D).
Explanation:
please help. Due in the morning.
Answer: See below
Explanation:
The Male P1 Mouse: BB
The Female P1 Mouse: bb
The first photo shows the genotype of the F1 generation, they are now heterozygous because they contain different alleles (Bb).
The black B is the dominant trait so they will all be black because they all have that B allele.
The second photo shows the F2 generation and shows that one of the four offspring would have bb which would be white while all others will be black.
Help asap…
1. In which organs is food moved through by peristalsis? (Choose all that apply)
A.stomach
B.small intestine
C.esophagus
D.liver
2. What is the substance produced by the liver that is necessary to break down fat drops into smaller fat drops?
A.bile
B.enzyme
C.acid
D.mucus
Answer:
1. A,B,C
2. A
Explanation:
1. Peristalsis is the automatic wave-like movement of the muscles that line your gastrointestinal tract. Peristalsis moves food through your digestive system, beginning in your throat when you swallow and continuing through your esophagus, stomach and intestines while you digest.
2. Bile is a fluid that is made and released by the liver and stored in the gallbladder. Bile helps with digestion. It breaks down fats into fatty acids, which can be taken into the body by the digestive tract.
what is the process that allows CO2 and glucose to enters the plants cells chloroplast
Answer: photosynthesis
Explanation:
photosynthesis
Plants use energy from sunlight to turn water and carbon dioxide into an energy-rich sugar called glucose. This process is called photosynthesis, which means “making things with light”. Photosynthesis takes place inside capsules in the leaf cells, called CHLOROPLASTS.
Water molecules moves out of a red blood cell and its shrivels is an example of.
A Protein Channel
B Simple Diffusion
C Facilitated Diffusion
D Osmosis
Answer: D Osmosis
Explanation: Water moves into and out of cells by osmosis
What’s the correct answer answer asap for brainlist
Actin and myosin come in and out of the cell to make it thicker or thinner which changes its length.
The correct option is B.
What is myosin in muscle contraction?Myosin contracts the myofibrils by sliding along myosin within the sarcomere, a process that demands ATP. Numerous molecules, including as calcium, troponin, and tropomyosin, that control muscle contractions and motor behaviors have also been found by researchers.
What are the uses of myosin?All hundred billion cells that make up the human body depend on myosins for growth and tissue creation, respiration, reproduction, communication, reshaping, and motion. Furthermore, myosins allow the quick invasion of bacteria, viruses, and parasites into eukaryotes host cells.
To know more about Myosin visit:
https://brainly.com/question/14988876
#SPJ13
The complete question is-
What is involve in a muscle contraction ?
A-The gap junction between the cells pull them close together which shortens the muscle.
B-Actin and myosin come in and out of the cell to make it thicker or thinner which changes its length.
C-Myofibrils in the muscle shorten ands lengthen to make the muscle D-contract and extend.
D-The extra nuclei trigger nerve to stiffen the muscles and make them shorter.
The cerebral cortex is divided into two halves called cerebral hemispheres. each cerebral hemisphere has three lobes, the parietal lobe, the frontal lobe, and the occipital lobe.
a. True
b. False
The cerebral hemisphere has four lobes, so the above statement is false.
What is Cerebral cortex?The Cerebral cortex also known as gray matter which comprises the brain’s outermost layer of nerve cell tissue and has a wrinkled appearance from its many folds and grooves. These folds have many groups called sulci and raised areas are called gyri.
These folds add to the surface area of cerebral cortex which allows large amount of information to be processed by Nerve cells. Cerebral cortex makes about half of the total brain mass. It consists of 6 layers which contains approximately 14 to 16 billion Nerve cells, thickness of about 0. 2 mm to 4 mm.
It is divided into four lobes. They are Frontal, Parietal, Temporal and Occipital which is responsible for processing different types of information.
It consist of nerve cell bodies which include end portion of Nerve cells called dendrites that's why it is also called gray matter. These dendrites receive chemical message from another cell cerebral cortex. It is gray in colour because lack of fatty covering of nerve which is called my myelin.
Thus, the cerebral hemisphere has four lobes, so the above statement is false.
Learn more about Cerebral hemisphere, here:
https://brainly.com/question/13543441
#SPJ12
A small group of foxes moved to a new environment, starting a new population.They began with a population of 10 foxes, and over the course of 2 years expandinto a population of 40. The population increased rapidly, but now food starts tobecome harder to find, and much of the living space is occupied. The populationstill grows, but at a decreased rate. Which part of the growth phase is thispopulation currently in?A. ExponentialB. LagC. TransitionalD. Plateau
When we are looking at a population we can see that passes through different stages, generally, there is a beginning or lag phase, then comes an accelerated gro also known as exponential or log phase, until the population stabilizes and reaches the ecosystem charge capacity, this is also known as stationary or plateau phase, therefore we can say that the correct answer is option D.
When we are looking at a population we can see that passes through different stages, generally, there is a beginning or lag phase, then comes an accelerated gro also known as exponential or log phase, until the population stabilizes and reaches the ecosystem charge capacity, this is also known as stationary or plateau phase, therefore we can say that the correct answer is option D.
Cutting is the easy technology to produce large number of vegetative seedlings at a time . How explain
Many plants, especially horticultural and garden varieties, are propagated through cuttings; by the use of new techniques, many other plants formerly not susceptible to propagation through cuttings have more successfully reproduced. The plants that develop from cuttings are clones.
Explanation:The cutting method is a technique of vegetative reproduction in plants. In this method, a branch of the stem is cut out from the plant and buried in the soil. New leaves arise from the nodes in the stem and the new roots also develop giving rise to a whole new plant. Example- rose, sugarcane. Cuttings can be made from any part of the plant. Most frequently, however, either a stem or leaf is used. A stem cutting includes a piece of stem plus any attached leaves or buds. Thus, stem cutting only needs to form new roots to be a complete, independent plant. A cutting is a section of plants such as a modified stem, leaf, or root used for vegetative propagation that forms either adventitious shoots, adventitious roots (stem and single node cuttings), or both (root and leaf cuttings). These are long pieces of roots which are used to artificially propagate new plants. For example, lemon, orange, blackberry, boysenberry, raspberry, etc. Cutting gives young children independent movements of each finger. Cutting with scissors works on the separation of two sides of the hand and strengthens hand muscles. Bilateral coordination is also addressed when they have to hold the scissors in one hand and the paper in the other. The four main types of stem cuttings are herbaceous, softwood, semi-hardwood, and hardwood. These terms reflect the growth stage of the stock plant, which is one of the most important factors influencing whether or not cuttings will root. You will get greater uniformity (clones) of your plants. The plant will reach maturity at an earlier age. When a recipe specifies how to cut an ingredient, it is important to follow the instructions because using the proper cutting technique will affect the dishes cooking time and will help ensure the food cooks more evenly and maximizes flavour.
Cutting is the easy technology to produce large number of vegetative seedlings at a time because the plants which are not susceptible can be easily propagated through this.
What is Vegetative propagation?
Many plants, especially those of horticultural and garden varieties, are propagated through cuttings. By the use of new techniques, many of the other plants formerly those which are not susceptible to the propagation of plants through cuttings which have more successfully reproduced. The plants that develop from cuttings are clones.
Most of the plant cuttings include stem pieces, and these have no root system of their own, and are therefore likely to die from dehydration of plant parts if the proper conditions are not met. Plant cuttings require a moist medium, which, however, cannot be too wet as this can rot the plant cutting. A number of media which are used in this process include however are not limited to soil, perlite, expanded clay pellets, and even water if given the right conditions. Most of the succulent cuttings can be left in open air until the cut surface dries, which may improve the formation of root when the cutting is later planted.
Learn more about Vegetative Propagation here:
https://brainly.com/question/1213600
#SPJ2
Name and describe at least two applications for population estimates.
How can photochemical smog impact the environment? It can increase the number of insects in the area. It can reduce the amount of plastic in the ocean. It can increase tree and plant growth in a city. It can decrease the crop yield in a region.
The Photochemical smog impact the environment by decrease the crop yield in a region.
Photochemical Smog- When nitrogen oxides & organic compounds (VOCs) combine with sunlight, a mixture of pollutants called photochemical smog is produced, which explains why there is a brown cloud above cities. Due to the fact that we receive the most sunshine in the summer, it tends to happen more frequently. primary contaminates.
Global warming is being caused by the massive amount of fossil fuels which being consumed, which is increasing the amount of acid rain & photochemical smog produced as well as the quantity of atmospheric carbon dioxide.
To know more about the Photochemical Smog, click on the below link,
https://brainly.com/question/15728274
#SPJ1
Hi I’m not sure if I’m right with this Question I need some help please and thank u
The reason why these cells can develop too many tasks at once, beyond having the specific genes expressed, is that they can constantly produce usable forms of energy in form of ATP by using glucose in cellular respiration. So the correct answer to this question is the final one.
How does active transport differ from all other forms of transportation?A. It shifts from high to lowB. It maintains homeostasisC. It creates an equilibrium shiftD. It requires energy
The correct answer is the letter D. It requires energy
*Active transport requires energy (ATP) in order to move molecules across the membrane. It needs energy since it moves molecules against a concentration gradient.
Question 11
You read a news report about a recent large volcanic eruption. It was reported
that the eruption was highly explosive with viscous lava. What type of volcano was
likely responsible for the eruption?
(Hint: the most explosive, dangerous kind)
A cinder cone
B composite
Cshield
The type of volcano was likely responsible for the eruption volcano to its formation would be the composite volcano wherein it usually yields large and violent eruptions.
What is volcano?A volcano has been defined as the hill or mountain or it has an opening in a planet or moon's crust from which molten rock, warm gases, and materials erupt. It has a landform where molten rocks erupt through the surface of the planet and volcano moutains open downwards to molten rocks.
According to Geologists there's are four types of volcanoes and these are lava domes, shield volcanoes, composite volcanoes, and cinder cones.
Therefore, The type of volcano was likely responsible for the eruption volcano to its formation would be the composite volcano wherein it usually yields large and violent eruptions.
Learn more about volcano on:
https://brainly.com/question/13428729
#SPJ1
Which of the following is not a means of locomotion in protists?stigmaflagellaciliapseudopod
Between the options the only one that is not a mean of locomotion in protists is the stigma, that is a plant structure and not a locomotion strategy . All the others are locomotion strategy for protists.
Why are video games so fun? Can any one explain, i'm just so confused
Answer:
I really don't know
Explanation:
Each video game is addictive for different reasons. Also, each person may find different elements of a game addictive. Although every case is unique, there are general patterns that can help explain why video games are addictive.
Video games are addictive because they help meet our basic psychological need for a sense of freedom, purpose/progress, and social connection.
Let’s take a closer look at each of these factors.
Video games offer a sense of freedom
Video games can be addictive because they offer a high degree of freedom that is unparalleled outside gaming environments. Let’s take a look at a few ways video games facilitate a sense of freedom.
Video games allow you to escape from social constraints.
From fantasy science fiction worlds to realistic combat environments, games allow a person to escape from the normal constraints of the offline world. This is especially relevant for someone struggling with social anxiety.
Offline social interaction can be challenging for individuals who find social situations anxiety-provoking, confusing, or over-stimulating. Games offer an escape from the constraints of social anxiety, providing a sense of freedom and control.
Although games serve as a short-term escape, avoiding in-person social situations comes at a long-term cost. Rather than facing one’s fears and dealing with the anxiety, games offer virtual freedom while keeping an individual dependent on the game as a form of escapism. Using games to avoid difficult emotions can lead to increased use over time, making in-person interaction even more difficult.
Video games allow you to experiment with different identities.
By experimenting with one’s personal gaming avatar, games offer the chance to try out new identities instantly, without the long-term social implications of the offline world.
This can be especially engaging for individuals who are dissatisfied with their offline identity, suffer from low self-esteem, or feel they cannot express certain aspects of their identity in their offline social context.
Identity experimentation through games can be healthy and liberating, but it can also be detrimental to developing one’s offline identity and sense of self-esteem. This is especially relevant if games serve as a form of escape or way to avoid confronting deeper self-esteem issues.
Video games offer a sense of adventure.
Games offer the infinite ability to explore new worlds. For those high in novelty-seeking, gaming environments offer a high level of exploration and experimentation without the dangers present in the offline world.
The modern world can often seem mundane, especially if you are bored and dissatisfied in your work or schooling. Gaming environments offer a way out of this monotony of everyday life and can be addictive because of the infinite possibilities they present.
Video games offer a sense of purpose
Video games can be addictive because they offer a strong sense of mission and purpose. Let’s take a closer look at how games offer a sense of purpose.
Video games facilitate a sense of progress through leveling up.
Games offer a sense of progress through their mission orientation. In addition, players gain a sense of mastery when their skills improve. This mission orientation and skill improvement are symbolized by character development, resource acquisition, leveling up to new environments, and various point systems.
This sense of progression can be especially rewarding for someone who feels like they are in a rut in their offline life. Games offer a way to meet our basic need to feel like we are progressing, even if it is virtual.
Another addictive feature common in games is their variable-ratio reward schedule. Like slot machines, games are designed with features that randomly reward players, keeping them hooked on a sense of anticipation. Loot boxes are a common form of this reward structure.
Video games with no defined end encourage infinite play.
Games with no defined endpoint encourage long-term investment. This can be addictive because the more time and energy one invests into an activity, the more difficult it is for them to simply abandon all of their efforts.
In addition, long-term play with a specific avatar builds a sense of identity investment, making it more difficult to let go.
Complete a Punnett square on your own in order to answer the question: A purple flowered daisy plant is crossed with a red flowered daisy plant. What is the probability of producing a purple flowered daisy plant?
A cross between a purple flower (BR) and a red flower (RR) will result to:
BR - 50% purple flowers
RR - 50% red flowers
Purple flower is a cross between blue and red flower which is a dilution of two dominant traits (blue and red color) resulting to a new heterozygous phenotype (purple flower).