Answer: An allele of a gene is said to be dominant when it effectively overrules the other (recessive) allele.
Explanation:
Which of the following is NOT found in saliva? A) urea and uric acid. B) electrolytes. C) lysozyme. D) protease. D) protease.
Proteases enzyme is not found in saliva , hence option 'D' is correct
The natural execration occurs from salivary gland, thus it accounts for high concentration of urea and uric acid found in saliva. Since the amount of creatinine production is consonant in 24 hours , uric acid and urea -to- creatinine ratio are better to clarify the changes of this compound concentration in saliva . Therefore option A is incorrect.
The main inorganic components are sodium , potassium, chloride, calcium, phosphate , and bicarbonate , all contributing to the ionic strength of saliva. Therefore option B is incorrect.
As an important part of the non specific immune defense mechanism , lysozyme is an important component of antibacterial in saliva. Therefore option C is incorrect.
Proteases are released by pancreas into the proximal small intestine ,where the mix with proteins already denatured by gastric secretion's and break down into amino acids. Therefore option "D" is correct.
To know more about Saliva :-
https://brainly.com/question/13267927
what type of motor neurons ensure that the spindle continues to provide information about muscle length during muscle contraction?
Answer: Gamma motor neurons
Explanation:
Gamma motor neurons innervate the intrafusal muscle fibers to set the sensory sensitivity to static and dynamic changes in muscle length.
Hope this helped!
Is Lightning striking the ocean a chemical or physical change?
Answer: chemical change
Explanation:
The image below compares a normal DNA
sequence and one mutated to produce sickle
cell. Describe how the DNA strand has
been mutated and examine the amino
acid sequence. Is this a frameshift
mutation? How do you know?
Hemoglobin DNA strand
ATGGTGCACCIGACTCCTGAGGAGAAG
amino acid sequence (val his leu thr pro glu glu
Sickle cell hemoglobin DNA strand
ATGGTGCACCTGACTCCTGTGGAGAAG
amino acid sequence val his leu thr pro val glu
The image is unattached. A DNA strand can be mutated through various mechanisms, such as exposure to ultraviolet light, radiation, and certain chemicals, or spontaneous errors during DNA replication.
How is the DNA strand mutated?These mutations can take the form of base substitutions, insertions, or deletions, and may affect a single nucleotide or a larger segment of DNA.
Amino acid sequences are determined by the sequence of nucleotides in a DNA strand. In the process of transcription, DNA is copied into RNA, and during translation, the RNA is read by ribosomes and translated into a sequence of amino acids, forming a protein. Each set of three nucleotides, called a codon, corresponds to a specific amino acid. If a mutation occurs in a DNA strand, it may alter the sequence of codons, which in turn could lead to a change in the amino acid sequence of the resulting protein.
To examine the amino acid sequence, the mutated DNA sequence must first be transcribed into RNA, and then translated into a protein. The resulting amino acid sequence can be analyzed and compared to the original, non-mutated sequence to determine the effects of the mutation.
Read more on DNA strand here:https://brainly.com/question/29037480
#SPJ1
what are the possible blood types of a child whose parents have the following blood types: father, type o; mother, heterozygous for type a.
Possible blood types of a child whose parents have type O and heterozygous for type A are A and O.
The blood type of a person is determined by the type of antigen present on the surface of the red blood cells (RBCs). The ABO blood group system is a widely accepted and common method for categorizing blood types. Blood groups A, B, AB, or O are the four blood types that are commonly found in humans. Therefore, when it comes to determining the potential blood type of a child, we must first examine the parent's blood type.
We now know that the father has type O, while the mother is heterozygous for type A. This means that she has one copy of the A antigen gene and one copy of the O antigen gene. As a result, the possible blood types of a child born to such parents are A and O.
Learn more about blood types at https://brainly.com/question/20672267
#SPJ11
in hemoglobin mckees rocks, point mutation occurs at the codon for tyrosine (uau) to stop codon uaa. what kind of point mutation is this?
In hemoglobin mckees rocks, point mutation occurs at the codon for tyrosine (uau) to stop codon uaa. This is an example of a nonsense mutation.
A nonsense mutation is a point mutation that results in the formation of a stop codon, causing a premature end to the mRNA strand. In this example, the codon for tyrosine (UAU) is changed to a stop codon (UAA). This mutation causes the truncation of the mRNA strand, which results in the production of an incomplete and often non-functional protein.
It can have severe consequences, depending on where in the gene sequence they occur. In some cases, the mutated gene may still produce some functional protein, but not at the expected levels. In other cases, the mutated gene may produce no functional protein at all. Furthermore, a nonsense mutation may cause a gene to produce a truncated protein that is harmful to the organism.
Overall, nonsense mutations are a type of point mutation that results in a premature termination of the mRNA strand. This can have a variety of consequences, depending on where in the gene sequence the mutation occurs and the type of protein being produced.
For more such questions on Point mutation.
https://brainly.com/question/30104873#
#SPJ11
PLSSSS HELP IF YOU TURLY KNOW THISSS
Which type of cloud is very close to the earth's surface?
FogThe altostartus clouds are found in the upper troposphere
The cirrus clouds are found in the troposphere
The cumulonimbus clouds are found in the lower troposphere...
what was the first disease shown to be bacterial in origin? what was the first disease shown to be bacterial in origin? cholera malaria yellow fever tuberculosis anthrax
The first disease shown to be bacterial in origin was cholera. It is characterized by diarrhea, vomiting, and dehydration
Cholera is an acute gastrointestinal infection caused by the bacteria Vibrio cholera, which is found in contaminated water or food. In 1854, John Snow, an English physician, concluded that cholera was spread through water contaminated with feces, leading to the first scientific demonstration that a disease was caused by bacteria. This realization was an important milestone in the history of medicine, as it showed that diseases were caused by microorganisms and could be prevented and treated by controlling their environment. Cholera remains an important disease, especially in developing countries, where sanitation is often poor and water-borne diseases are common.
Learn more about Cholera: https://brainly.com/question/3837264
#SPJ11
the red portion of the human lip: question 12 options: integumentary lip. has no facial markings. must be treated by hypodermic tissue building in every case. mucous membrane.
The red portion of the human lip is known as the mucous membrane. It does not have any facial markings and must be treated by hypodermic tissue building in every case.
The mucous membrane is a layer of tissue that lines various parts of the body's openings and cavities that are in contact with the outside environment. It is a moist membrane that secretes mucus, a slimy substance that assists in trapping germs and other foreign substances, as well as keeping the surface moist.
The red portion of the human lip: Mucous membrane. The red portion of the human lip is the mucous membrane. The mucous membrane of the lips is often known as the vermilion zone. It is a transition zone between the skin and the mucous membrane.
Read more about membranes:
https://brainly.com/question/940770
#SPJ11
on the cellular level, how is gastrulation accomplished in echinoderms, amphibians, and birds? in general terms what does gastrulation accomplish?
Gastrulation in echinoderms, amphibians, and birds is accomplished through the invagination of different cells.
In general, gastrulation is the process that reorganizes cells to form the three germ layers, which are necessary for the further development of an organism.
Gastrulation is the process in which cells rearrange to form the three germ layers: the ectoderm, mesoderm, and endoderm.
In echinoderms, gastrulation is accomplished through the process of archenteron formation, which is when the mesoderm forms from the invagination of cells from the surface of the embryo.
In amphibians, gastrulation is accomplished through blastopore closure, which is when the opening at the blastula stage of the embryo closes.
In birds, gastrulation is accomplished through the formation of the primitive streak, which is when the ectoderm folds and inwards to form a groove-like structure.
In summary, gastrulation is the first step of morphogenesis, the development of form and structure, which will determine the shape of the organism. The three germ layers will further differentiate and develop into the organs, tissues, and cells that make up the organism.
To know more about gastrulation, refer here:
https://brainly.com/question/15839332#
#SPJ11
type iii hypersensitivity is caused by soluble antigen-antibody complexes that avoid being phagocytized by macrophages. true false g
Type III hypersensitivity is caused by soluble antigen-antibody complexes that avoid being phagocytized by macrophages. This statement is true.
What is type III hypersensitivity?Type III hypersensitivity occurs when a large amount of antigen enters the body and combines with an antibody, forming an insoluble complex. These are difficult to eliminate, and they begin to settle in the tissues, particularly those with a low blood supply and a high concentration of protein. They elicit an inflammatory response and, as a result, the release of proteases, hydrolases, and complement factors is increased.These immune complexes can become stuck in blood vessels or other organs, resulting in symptoms such as joint pain, fever, and rash. These symptoms usually manifest in the tissues where the complexes are deposited.
What are the causes of type III hypersensitivity?The causative agents of Type III hypersensitivity are usually proteins, such as serum proteins or microbial proteins, that combine with specific antibodies to form circulating immune complexes. If the immune complexes become deposited in the blood vessels, they can result in vasculitis, inflammation, and subsequent tissue damage. Type III hypersensitivity is responsible for diseases like systemic lupus erythematosus, rheumatoid arthritis, and serum sickness.
Here you can learn more about Type III hypersensitivity
https://brainly.com/question/13000105#
#SPJ11
How long will most likely take before Isla education is finished and she is ready to begin working? Oh she just graduated veterinary school.
A. It should be within the week because the program is a weekend one
B. They can plan for next month as the training only takes a few weeks
C. It will likely be several months before Isla is ready to work.
D. Taking on this course means that Isla has at least three more years of school
Answer:
C. It should be within the week because the program is a weekend one
imagine a condition where the vessels that carry blood between the lungs and the body tissues were permeable to oxygen. what would you expect to observe relative to the normal condition of low permeability to oxygen in the vessels that carry blood from the lungs to the tissues?
If the vessels between the lungs and body tissues were permeable to oxygen, there will be a decrease in the oxygen supply to the body tissues.
Normally, oxygen-poor blood from the body tissues flows into the right side of the heart, and is then pumped to the lungs where it picks up oxygen and releases carbon dioxide. The oxygen-rich blood then flows back to the left side of the heart, where it is pumped out to the body tissues to supply oxygen to the cells.
If the vessels between the lungs and body tissues were permeable to oxygen, oxygen-rich blood from the lungs would flow into the right side of the heart, mix with oxygen-poor blood from the body tissues, and then be pumped out to the body tissues.
This would result in a reduced delivery of oxygen to the tissues, as some of the oxygen-rich blood from the lungs would bypass the body tissues and flow back to the lungs.
Learn more about oxygen here:
https://brainly.com/question/6560167
#SPJ11
describe the zones of the epiphyseal plate and their functions, and the significance of the epiphyseal line.
The epiphyseal plate, also known as the growth plate, is composed of four zones: the resting zone, the proliferative zone, the hypertrophic zone, and the calcified zone. The epiphyseal line, or growth line, is the division between the epiphyseal plate and the diaphysis and is where all growth stops.
The resting zone is the first zone in the epiphyseal plate and is located at the epiphyseal side of the plate. It contains cells that are inactive but can divide to form more chondrocytes, which are essential for the formation of bone and cartilage.
The proliferative zone is the second zone and is the site of cell division and growth.
The hypertrophic zone is the third zone and is the site of most growth. It is also the site of most of the extracellular matrix mineralization, as chondrocytes in this zone produce high levels of collagen and other matrix proteins.
The calcified zone is the fourth and last zone and is composed of cells that are no longer able to divide or grow. It contains mature, mineralized cartilage.
Learn more about epiphyseal plate at https://brainly.com/question/29620826
#SPJ11
Which idea of evolution is supported by the existence of vestigial structures?
The existence of vestigial structures supports the idea of evolution by natural selection.
Anatomical traits known as vestiges are those that, as a result of evolution, have lost their original purpose over time. These structures are frequently the remains of characteristics that were once beneficial to an organism's progenitors but are no longer required for the organism to survive or reproduce in its current environment.
Vestigial structures are indicators of the evolutionary history of life on Earth and are found in all living things. It implies that organisms have changed over time and that certain once-useful structures have been rendered useless as a result of adaptations to new surroundings and natural selection.
According to the theory of evolution by natural selection, organisms with beneficial qualities have a higher chance of surviving and reproducing, passing those traits on to subsequent generations.
TO know more about natural selection click here
brainly.com/question/8159744
#SPJ4
What are the main functions of the ear? Please respond in 1-2 complete sentences
using your best grammar.
Hearing, Balance and equilibrium: The ear is also very important for keeping your balance and equilibrium, which is important for your posture, movement, and sense of where you are in space.
Pressure regulation: The Eustachian tube, which connects the middle ear to the back of the throat, is opened and closed by the ear. This helps keep the pressure in the middle ear at the right level.
Protection: Hair and wax line the ear canal, which helps keep dust, dirt, and other foreign particles from getting into the ear's delicate structures.
Temperature regulation: When the temperature outside changes, the ear responds by widening or narrowing the blood vessels in the ear.
Learn more about ear here:
https://brainly.com/question/29255597
#SPJ1
what was the control group in this study? a the transplanted population in the killifish pools b the transplanted population in the pike-cichlid pools c the source population in the killifish pools d the source population in the pike-cichlid pools
In an ecological study involving killifish and pike-cichlid pools, the control group is the source population in the pike-cichlid pools as it did not receive any intervention in the study.
In a study, the control group refers to the group that does not receive any treatment or intervention and is used as a comparison to the experimental group. In this scenario, the source population in the pike-cichlid pools is the control group as it did not receive any intervention in the study. The study is not mentioned in the question, but based on the options provided, it is likely an ecological study involving killifish and pike-cichlid pools. The transplanted population is most likely the experimental group. The source population in the killifish pools and the source population in the pike-cichlid pools are both control groups that did not receive any intervention in the study.
To learn more about Ecological :
https://brainly.com/question/1331136
#SPJ11
procaine (novocaine) is metabolized primarily by the group of answer choices liver. lungs. plasma. kidneys.
Answer: plasma
Explanation:
In the same mouse species, a third unlinked gene (gene C/c) also has an epistatic effect on fur color. The presence of the dominant allele C (for color), allows the A/a and B/b genes to be expressed normally. The presence of two recessive alleles (cc), on the other hand, prevents any pigment from being formed, resulting in an albino (white) mouse.Matchthe phenotypes on the labels at left to the genotypes listed below. Labels can be used once, more than once, or not at all.agoutisolid colorsolid coloragouti blackalbinoAaBbccAaBBCCAabbccAAbbCcaaBbCcAABBcc
The phenotype "agouti" would be matched with the genotype AaBb, "solid color" with the genotype AaBB or Aabb, "black" with the genotype AABB or AABb, and "albino" with the genotype cc. This is because the presence of the gene C/c (epistasis) determines the fur color of the mouse, and the genotypes above show the different combinations of alleles. If two recessive alleles (cc) are present, it will result in an albino (white) mouse.
Explanation:
Physical characteristics like the fur color of a mouse are determined by the combination of genes in the organism's DNA. Epistasis is a phenomenon in which the expression of one gene affects the expression of another gene. When an organism reproduces, genes are inherited by offspring from their parents. In the context of this problem, the genes involved in determining fur color are A/a, B/b, and C/c. C is the gene that has an epistatic effect on fur color.
Here, are the matched genotypes with phenotypes: AaBbcc - agouti solid colorAaBBCC - solid colorAgouti black - AAbbCc, AaBbCcAlbino - aabbcc, aabbCc, aabbCC, aaBbcc, aaBbCc, aaBBcc.The label agouti solid color matches with the genotype AaBbcc. The solid color matches the genotype AaBBCC. The label agouti black matches with the genotypes AAbbCc and AaBbCc. The label albino matches with the genotypes aabbcc, aabbCc, aabbCC, aaBbcc, aaBbCc, and aaBBcc.
To know more about the Epistatic effect, visit:
https://brainly.com/question/30971240
#SPJ11
meiosis divides one cell into four cells, but the resulting cells have half the amount of dna as compared to the original cell. how do you think this is possible?
During meiosis, one cell is divided into four cells, but the resulting cells have half the amount of DNA as compared to the original cell. This is because of the two cell divisions, meiosis I and meiosis II, that occur during meiosis.
During meiosis I, homologous chromosomes separate, resulting in two cells with half the number of chromosomes as the original cell.
During meiosis II, sister chromatids separate, resulting in four cells, each with half the number of chromosomes as the original cell.
In other words, the resulting cells have half the amount of DNA because meiosis results in four cells, each containing half the number of chromosomes and, therefore, half the amount of DNA as the original cell.
Here you can learn more about meiosis
https://brainly.com/question/7002092#
#SPJ11
you move e.coli that were grown in 15n to 14n media. if dna replication is conservative, what would you predict to see after 20 minutes (1 generation time)?
You would predict to see a mixture of 15n and 14n DNA after 20 minutes in this conservative DNA replication.
This is because conservative DNA replication means that parental strands are kept intact, with only newly synthesized strands containing the new nucleotide. Therefore, after 20 minutes, the 15n and 14n will be present in equal proportions, as both strands of the parent DNA strands were replicated in the new media.
In conservative DNA replication, the parent strands of the DNA remain intact as the newly synthesized strands contain the new nucleotide. This means that after 20 minutes, the parental strands are still present and now the newly synthesized strands are present with the new nucleotide. Therefore, the original 15n and the new 14n will both be present in equal proportions. The new strands are synthesized in a semiconservative fashion, meaning the parental strands are conserved and the newly synthesized strands contain the new nucleotide. Therefore, after 20 minutes, the mixture of 15n and 14n will be present in equal proportions.
To know more about DNA click on below link:
https://brainly.com/question/264225#
#SPJ11
which of the following is not part of bergmann's rule? group of answer choices longer limb lengths are predicted in hot climates larger body is predicted in cold climates smaller body mass is predicted in hot climates b and c only none of the above
Bergmann's rule is a biogeographic rule that states that warm-blooded animals living in colder climates will typically be larger in size than those living in warmer climates. The correct answer is option C, which is smaller body mass is predicted in hot climates.
According to Bergmann's rule, a larger body size is predicted in colder climates. This is because larger animals have a smaller surface area to volume ratio, which helps them retain heat more effectively in cold environments. Smaller animals have a larger surface area to volume ratio, which makes it harder for them to retain heat in cold environments. However, Bergmann's rule does not predict smaller body size in hot climates. Instead, it predicts longer limb lengths in hot climates. This is because longer limbs have a larger surface area to volume ratio, which helps animals dissipate heat more effectively in hot environments. Therefore, option C is the correct answer. Bergmann's rule is one of several biogeographic rules that describe patterns in the distribution and evolution of animals around the world. These rules can be useful in understanding how animals adapt to their environment and how they may respond to climate change.
To learn more about Climates :
https://brainly.com/question/31173175
#SPJ11
transport of a solute across a membrane where the solute is going up its concentration gradient and using protein carriers driven by the expenditure of chemical energy, is known as
Transport of a solute across a membrane where the solute is going up its concentration gradient and using protein carriers driven by the expenditure of chemical energy is known as active transport.
What is active transport?Active transport is the movement of molecules against the concentration gradient, which means moving from lower to higher concentrations. It involves a direct energy source (ATP) to drive the movement of molecules. The active transport method involves the use of protein pumps to move molecules across the cell membrane. These pumps can help move molecules, including sodium, calcium, and potassium, against the concentration gradient, which allows the cell to regulate what enters and exits. During active transport, the cell must use energy in the form of ATP to transport the molecules.
In summary, the transport of a solute across a membrane, where the solute is going up its concentration gradient and using protein carriers driven by the expenditure of chemical energy, is known as active transport. Active transport requires energy, which is provided by the hydrolysis of ATP. Active transport is necessary because it allows the cell to maintain its internal environment despite the external environment's changes.
Here you can learn more about active transport
https://brainly.com/question/29759743#
#SPJ11
if pure water and a solution containing a nonpenetrating solute are separated by a membrane that is permeable only to water, what would occur?
If pure water and a solution containing a nonpenetrating solute are separated by a membrane that is permeable only to water, osmosis will occur.
Osmosis is the movement of water molecules across a membrane in order to equalize the solute concentration on either side. As the solute molecules are unable to pass through the membrane, only the water molecules are allowed to pass. This results in the transfer of water molecules from the pure water to the solution containing a nonpenetrating solute, thus increasing the solute concentration on the pure water side and decreasing the concentration on the other side. In the end, equilibrium is achieved and the water molecules will stop moving.
For more such questions on Osmosis.
https://brainly.com/question/31028904#
#SPJ11
how does binding of complement-opsonized microbes to cr1 facilitate clearing of the microbe from the host?
The complement-opsonized microbe binds to CR1 receptors located on phagocytic cells, such as macrophages and neutrophils. This binding triggers the phagocyte to engulf the microbe and remove it from the host. The binding also helps the phagocyte to recognize the microbe, which can be beneficial in the case of microbes which do not cause damage to the host.
The binding of complement-opsonized microbe to CR1 also activates the complement cascade, which helps to remove the microbe more quickly by opsonizing additional targets and by recruiting more immune cells.
In addition, binding of the microbe to CR1 triggers release of cytokines and chemokines, which attract additional immune cells to the site of infection and activate them. This increases the chances of clearing the microbe from the host.
Know more about phagocyte here:
https://brainly.com/question/16185213
#SPJ11
wo parts to this question: when you hear the terms chief cells, parietal cells and enteroendocrine cells, where are we in the body and what step in the digestive process are we involved with? your answer:
The terms chief cells, parietal cells, and enteroendocrine cells refer to specific cell types found in the stomach. These cells are involved in the digestive process of breaking down food.
Parietal cells are found in the lining of the stomach and are responsible for producing hydrochloric acid, which lowers the pH of the stomach and helps to break down food. Parietal cells also produce intrinsic factor, which is necessary for the absorption of vitamin B12.
Chief cells, also found in the stomach lining, produce and secrete pepsinogen, an inactive enzyme that is converted to the active enzyme pepsin in the presence of hydrochloric acid. Pepsin breaks down proteins into smaller peptides, aiding in the digestive process.
Enteroendocrine cells are scattered throughout the lining of the stomach and small intestine and produce various hormones that regulate digestion and appetite.
Chief cells, parietal cells, and enteroendocrine cells are all involved in the digestive process in the stomach. Parietal cells produce hydrochloric acid and intrinsic factors, chief cells produce pepsinogen, and enteroendocrine cells produce various hormones that regulate digestion and appetite.
To learn more about enteroendocrine cells
https://brainly.com/question/6709917
#SPJ4
a gardener would like to grow a lemon tree from a lemon. what is the first thing he should do?
If a gardener wants to grow a lemon tree from a lemon, the first thing he should do is to remove the seeds from the lemon to germinate.
A gardener who wants to grow a lemon tree from a lemon should follow a series of steps. These steps are as follows:
Step 1: Remove the seeds from the lemon. The seeds should be washed and cleaned with water. The gardener should be careful not to damage the seeds.
Step 2: Prepare the soil. The soil should be well-draining, rich in nutrients, and have a pH of 5.5 to 6.5. The gardener can mix sand, perlite, and vermiculite to the soil to increase its drainage.
Step 3: Plant the seeds. The gardener should plant the seeds about 1 inch deep into the soil. The soil should be moist but not waterlogged.
Step 4: Cover the pot with a plastic bag or a plastic wrap to create a greenhouse effect.
Step 5: Place the pot in a warm and sunny location. The temperature should be around 70 degrees Fahrenheit.
Step 6: Water the soil regularly. The soil should be kept moist but not waterlogged.
Step 7: Wait for the seeds to germinate. It may take a few weeks to a few months for the seeds to germinate.
Step 8: Once the seedlings have grown big enough, they can be transplanted into a bigger pot. The plant should be kept in a warm and sunny location. The soil should be kept moist but not waterlogged.
Step 9: The lemon tree should be fertilized with a citrus fertilizer every two weeks during the growing season.
Step 10: The lemon tree should be pruned regularly to remove dead, damaged, or diseased branches.
To know more about germination, refer here:
https://brainly.com/question/15976369#
#SPJ11
when jeremy smith was in the shower, the hot water ran out. the cold water caused the hairs on his skin to stand up. this body response to cold is known as . group of answer choices exfoliation anhidrosis piloerection perspiration
Jeremy Smith's body response when the cold water caused the hairs on his skin to stand up is known as piloerection.
Thus, the correct answer is piloerection (D).
Piloerection in humаns is аn аutonomic response observed during а vаriety of strong emotionаl experiences, including feаr аnd аnger, аesthetic pleаsure, аwe, аnd surprise.
Piloerection, also known as goosebumps or goose pimples, is the erection of the hаir of the skin due to contrаction of the tiny аrrectores pilorum muscles thаt elevаte the hаir follicles аbove the rest of the skin аnd move the hаir verticаlly, so the hаir seems to 'stаnd on end.'
For more information about piloerection refers to the link: https://brainly.com/question/28988562
#SPJ11
Help with my biology please
Carbohydrates are composed of monosaccharides, proteins are composed of amino acids, and nucleic acids are composed of nucleotides.
What are the elements present and the building blocks in carbohydrates, proteins, and nucleic acids?Carbohydrates, proteins, and nucleic acids are three major classes of biomolecules that are essential for life.
Here are the elements present and the building blocks of each:
Carbohydrates:
Carbohydrates are organic molecules that contain carbon, hydrogen, and oxygen in the ratio of 1:2:1. The building blocks of carbohydrates are monosaccharides, which are simple sugars that cannot be broken down into smaller molecules. Examples of monosaccharides include glucose, fructose, and galactose.
Proteins:
Proteins are complex molecules that are made up of amino acids. Amino acids contain carbon, hydrogen, oxygen, nitrogen, and sometimes sulfur. There are 20 different types of amino acids, and they are joined together by peptide bonds to form polypeptide chains, which fold into specific three-dimensional structures to form proteins.
Nucleic acids:
Nucleic acids are macromolecules that store and transmit genetic information. They are composed of nucleotides, which are made up of a nitrogenous base, a sugar, and a phosphate group. The four nitrogenous bases in DNA are adenine, guanine, cytosine, and thymine, while in RNA, uracil replaces thymine. The sugar in DNA is deoxyribose, while in RNA, it is ribose. The nucleotides are joined together by phosphodiester bonds to form a linear chain called a polynucleotide.
Learn more about macromolecules at: https://brainly.com/question/5246898
#SPJ1
problem 5: in an alaskan village of inuit indians, an inordinate number of cats have 6 toes on each foot. the trait of polydactyly (many digits) is caused by a dominant allele. if 22% of the cats have 6 digits per foot, what is the allele frequency of this dominant allele in this population of cats?
The allele frequency of the polydactyly (many digits) trait in the population of cats in the Alaskan village of Inuit Indians is 0.22 (22%).
Polydactyly is caused by a dominant allele, meaning that the allele is expressed in the organism even when the organism only has one copy of it.
This means that in the population of cats, 22% of them are expressing the trait, indicating that 22% of the cats have one or two copies of the dominant allele for polydactyly.
In order for the cats to have this trait, at least one of their parents must have the same dominant allele, meaning that the parents of the cats expressing the trait must have a combined allele frequency of 0.22 (22%) or more.
The allele frequency of 0.22 (22%) is then passed on to the offspring of the cats expressing the trait, meaning that the cats expressing the trait must have a combined allele frequency of 0.22 (22%) or more.
This means that 22% of the cats in the population have either one or two copies of the dominant allele for polydactyly.
To learn more about allele, click here:
https://brainly.com/question/7602134
#SPJ11