The enzyme produced in the gastrointestinal tract organ would first go through the co-translational pathway in order to be localized to the lumen of the GI tract organ.
The co-translational pathway is a protein targeting pathway that occurs during protein synthesis in which the newly synthesized protein is transported to its final destination while still being synthesized.
Specifically, the enzyme would travel to the rough endoplasmic reticulum (RER) where it would be translated into its active form by ribosomes.
After translation, the enzyme would be modified and transported to the Golgi apparatus where it would be further modified and finally released into the lumen of the GI tract via secretory vesicles.
Learn more about co-translational pathway here:
https://brainly.com/question/5705948
#SPJ11
fred had chicken pox as a child. which of his cells confer immunological memory to the chicken pox virus?
Answer:A lymphocyte (B or T cell) that retains a “memory” of a specific pathogen after an infection is over and thus provides immunity to the pathogen.
Explanation:
in humans, telomerase activity is most likely to be found in which cells? select one: red blood cells germ cells muscle cells all cells neurons
Telomerase activity in humans is most likely to be found in germ cells. The correct answer is b.
Telomerase is an enzyme that adds nucleotides to the ends of chromosomes to prevent them from becoming shorter after every division of the cell. This enzyme is found in some cells, particularly embryonic stem cells, adult stem cells, and cancer cells.
Germ cells are responsible for the creation of sperm and eggs in males and females, respectively. Germ cells are crucial to reproduction, and their genetic makeup is passed on from one generation to the next. When germ cells divide, they undergo many more cycles than other cell types.
As a result, they are more likely to experience telomere shortening, which is why telomerase activity is more common in these cells.
Here you can learn more about germ cells
https://brainly.com/question/6588742#
#SPJ11
What is the average for the following set of measurements?
7.1 g, 9.8 g, 2.3 g, 8.5 g, 7.4 g, 5.7 g
A. 9.8 g
B. 6.8 g
C. 8.2 g
• D. 40.8 g
Answer:
6.8g
Explanation:
All numbers are added together and you divide the total but the amount of numbers given.
All numbers added equals to 40.8
Numbers given equals 6
40.8 divided by 6 equals 6.8
during conjugation, the donor cell generally retains a copy of the genetic material being transferred. this is termed a blank process
Answer:
Conservative
Explanation:
During conjugation, the donor cell generally retains a copy of the genetic material being transferred. This is termed a conservative process.
how deos the arrangement and morphology of the palisade layer result in its being the major site for photosynthesis
The arrangement and morphology of the palisade layer result in its being the major site for photosynthesis because the palisade layer consists of elongated cells that contain a high number of chloroplasts, which are the sites of photosynthesis.
In photosynthesis, chloroplasts use light energy to synthesize organic compounds such as glucose from carbon dioxide and water. The palisade layer is located just beneath the upper epidermis of a leaf and is responsible for most of the photosynthesis that occurs within the leaf. The palisade layer contains a high density of chloroplasts, which are arranged perpendicular to the surface of the leaf in order to maximize light capture.The elongated shape of palisade cells allows for a greater surface area-to-volume ratio than in rounder cells, meaning that more chloroplasts can fit within the same amount of space.
Additionally, the narrow shape of the palisade cells allows light to penetrate deeper into the leaf, ensuring that more chloroplasts are exposed to light. Therefore, the arrangement and morphology of the palisade layer make it the primary site for photosynthesis.
Here you can learn more about the palisade layer
https://brainly.com/question/30627918#
#SPJ11
How many grams of neutral red would your instructor have used to create 100ml of a 4% w/v stock solution? ____ gm
Answer:0.0012
Explanation: 0.03×x/100
dna is double-stranded, but for each protein, only one of these two strands is used to produce an mrna transcript. what is the coding strand called?
The coding strand of DNA is also known as the sense strand or the positive strand.
It is called the coding strand because it contains the same sequence of nucleotides as the mRNA molecule that is produced during transcription. In other words, the coding strand has the same sequence as the mRNA, except that it has thymine (T) instead of uracil (U) since mRNA uses uracil instead of thymine.
The other strand of DNA, which is not used as a template for mRNA synthesis, is called the non-coding strand or the antisense strand, as it has a complementary sequence to the coding strand. During transcription, RNA polymerase reads the antisense strand and produces an mRNA molecule that is complementary to it, which is why it is called the template strand.
So, to summarize, the coding strand is the strand of DNA that has the same sequence as the mRNA transcript that is produced during transcription.
to know more about DNA refer to :
https://brainly.com/question/264225?referrer=searchResults
leucine aminopeptidases (laps) are found in all living organisms and have been associated with the response of the marine mussel, mytilus edulis, to changes in salinity. laps are enzymes that remove n-terminal amino acids from protein
Leucine aminopeptidases (LAPs) are a group of enzymes found in all living organisms, including the marine mussel Mytilus edulis. These enzymes play a crucial role in protein metabolism by catalyzing the cleavage of N-terminal amino acids from protein substrates.
LAPs have been implicated in a variety of physiological processes, including protein turnover, regulation of peptide hormone levels, and immune system function. In Mytilus edulis, LAPs have been shown to play a role in the organism's response to changes in salinity. When the salinity of their environment changes,
Mytilus edulis utilizes LAPs to modify the composition of proteins in their cells, allowing them to better adapt to the changing conditions. This adaptation is important for the organism's survival, as changes in salinity can significantly affect the functioning of cells and tissues.
Overall, LAPs are versatile enzymes that play a critical role in protein metabolism and are found in a wide range of living organisms, including the marine mussel Mytilus edulis. Their ability to modify protein substrates makes them important players in many physiological processes, including adaptation to changing environmental conditions.
For more details about aminopeptidases click here:
https://brainly.com/question/7175239#
#SPJ11
During crossing over, when the invading strand uses the invaded DNA as a _____, this automatically results in an extra copy of the invaded sequence at the expense of the invading sequence, thus explaining the departure from the expected _____ ratio.
The correct answer is: During crossing over, when the invading strand uses the invaded DNA as a template, this automatically results in an extra copy of the invaded sequence at the expense of the invading sequence, thus explaining the departure from the expected 1:1 ratio of crossing over.
Explanation:
DNA is replicated through the process of crossing over, which involves the exchange of genetic material between two homologous chromosomes. During the process, one of the homologous chromosomes acts as the invading sequence, while the other acts as the invaded DNA. When the invading strand uses the invaded DNA as a template, it results in an extra copy of the invaded sequence at the expense of the invading sequence, thus explaining the departure from the expected 1:1 ratio of crossing over.
What is crossing over?
Crossing over is a process during meiosis where the chromosome arms of maternal and paternal homologous chromosomes swap DNA sections (recombination) to produce new allelic combinations of traits. The crossing-over process starts with the breakage of two homologous chromosomes, the migration of the broken ends toward each other, and the formation of crosslinks by the formation of single crossovers.
These crosslinks are eventually converted to chiasmata that keep the chromosomal arms connected until metaphase I. During this process, one chromosome might lose genetic material while the other might acquire genetic material. This event results in unique combinations of genes that might not be present in either parent. The frequency of crossovers is affected by the distance between the gene and the centromere. Chromosomes that are nearer to the centromere are less likely to cross over than those that are further away. Explaining the departure from the expected Mendelian ratio.
The ratio of offspring created by a cross that exhibits the dominant and recessive traits that Mendel observed is referred to as the Mendelian ratio. Crossing over might result in new allelic combinations of genes that deviate from the Mendelian ratios. This is because the transmission of genes is no longer controlled by a single gene pair on a chromosome. Chromosome segregation is disturbed in one way or another by crossovers.
To know more about crossing-over process, visit:
https://brainly.com/question/11347292
#SPJ11
up to 25% of a cell's atp is used to run sodium-potassium pumps. without the resulting sodium and potassium gradients, neurons and muscles cannot fire properly. if a person is poisoned with cyanide, they cannot generate atp, and die within a few minutes. in relation to the sodium-potassium pump, what specific impact would cyanide have on concentrations across the cell membrane?
Cyanide depolarizes the peritubular cell layer by +18.8 +/ - 2.3 mV/10 min in the presence and by +4.5 +/ - 0.9 mV/10 min without even a trace of the luminal substrate.
Hydrogen cyanide is a poisonous little nonpolar particle that is delivered by certain plants to discourage herbivores. Cyanide crosses layers and restrains a critical cycle in the breath.
The cyanide particle, CN, ties to the iron molecule in cytochrome C oxidase in the mitochondria of the cells and goes about as an irreversible protein inhibitor. This keeps cytochrome C oxidase from doing what it needs to do, which is to send electrons to oxygen in the electron transport chain of high-impact cell breath.
To learn more about Cyanide depolarizes here
https://brainly.com/question/13030946
#SPJ4
when dna probes are used to identify bacterial dna similarities by hybridization, the probe dna is heated and the template dna is treated to separate the 2 strands. why would the probe dna be heated?
Answer:
The probe DNA is heated to denature or separate the two strands of the double-stranded DNA to make it single-stranded. This is because hybridization, the process of joining two complementary strands of DNA, can only occur between two single-stranded DNA molecules. By heating the probe DNA, it denatures and becomes single-stranded, allowing it to hybridize with the target DNA under specific conditions. The temperature at which the denaturation or melting occurs depends on the base composition of the DNA, specifically the amount of G-C pairs. This is known as the melting temperature or Tm.
Predict A store owner has a problem with birds building nests on top of the store’s
outdoor sign. To scare the birds away, she places rubber snakes on top of the sign.
Predict how the birds will react to the rubber snakes. Use the terms habituated,
learn, negative effects, positive effects, and stimulus in your answer.
Answer:
The birds may initially be frightened by the rubber snakes due to the sudden presence of a new stimulus. However, if they do not encounter any negative effects, such as being attacked or injured by the snakes, they may quickly habituate to their presence and no longer see them as a threat. This means that the birds may learn that the rubber snakes are not a danger and may continue to build their nests on the sign, ignoring the presence of the snakes. Therefore, the use of rubber snakes may have no positive effects in deterring the birds from building their nests, but rather may be ineffective or even have negative effects if the birds become habituated to them.
Explanation:
This is what I think hope it helps.
Where are the olfactory filaments found?
Answer:
nasal cavity
Explanation:
Olfactory filaments
The bipolar cell is the first-order sensory neuron located at the olfactory mucosa on the roof of the nasal cavity, immediately inferior to the cribriform plate of the ethmoid bone. This cell is analogous to the sensory cells of spinal nerves, whose cell bodies reside in the dorsal root ganglion.
the ability to predict the consequence of an action is located in the group of answer choices gustatory cortex. olfactory receptors. left cerebral hemisphere. prefrontal cortex. right cerebral hemisphere.
The prefrontal cortex is where one can forecast how an action will have an effect.
What area of the brain is in charge of anticipating the outcomes of events or actions?A wide range of executive processes are supported by the prefrontal cortex, including: concentrating one's thoughts. anticipating environmental events and anticipating the results of one's actions.
Which region of the brain is in charge of consciousness?The main component of the forebrain, the cerebrum, is the brain (or prosencephalon). The cerebral cortex, which is its dominant outer region, processes sensory and motor information as well as enabling consciousness, or our capacity to think about ourselves and the outside world.
To know more about prefrontal cortex visit:-
https://brainly.com/question/9941447
#SPJ1
Find the amino acid chain that forms from the mRNA sequence DNA
sequence below.
GATCGATACCATTCGGCGCATACTTCG
Answer:
mRNA= CUA GCU AUG GUA AGC CGC GUA UGA AGC
Amino acid chain=LEU ALA MET VAL SER ARG VAL STOP SER
Explanation:
Find the START codon (AUG). Start reading in groups of 3 and check against a codon table. When you get to a STOP (UAA, UAG, UGA) you’ve got that protein strand’s sequence.
Please help quick I’ll mark brainly
Why does the Northern hemisphere produce more CO2 overall? Why does it absorb more CO2 certain times of year?
Answer:
The Northern Hemisphere produces more CO2 overall for several reasons. One main reason is that it contains more land area and therefore more vegetation that undergoes photosynthesis, which takes in CO2. However, during the winter months, when the temperature drops, the vegetation goes dormant and stops absorbing CO2. At the same time, human activity, such as burning fossil fuels and heating buildings, tends to increase during the winter months, which leads to an increase in CO2 emissions. As a result, the Northern Hemisphere experiences seasonal variations in CO2 levels, with higher levels during the winter months and lower levels during the summer months when vegetation is actively growing and absorbing CO2. Additionally, the Northern Hemisphere experiences more seasonal variation in general, with more extreme temperatures and weather patterns that can affect the balance of CO2 in the atmosphere.
where does hemopoiesis occur? yellow bone marrow epiphyseal line red bone marrow nutrient foramina endosteum
Answer:
Red bone marrow
Explanation:
Hematopoiesis that occurs in your bone marrow is called medullary hematopoiesis. Blood cells get made in your bone marrow and released into your bloodstream. Less often, hematopoiesis takes place in other parts of your body, like your liver and spleen. Hematopoiesis that occurs outside of your bone marrow is called extramedullary hematopoiesis.
In adults, hematopoiesis of red blood cells and platelets occurs primarily in the bone marrow. In infants and children, it may also continue in the spleen and liver.
which segment of the ecg reflects the plateau phase of ventricular muscle cells' action potentials? select one: a. p-t segment b. q-r segment c. s-t segment d. t-p interval e. p-r interval
The segment of the ECG that reflects the plateau phase of ventricular muscle cells' action potentials is the S-T segment. The correct option is c. During the action potential, the electrical charge of a cardiac muscle cell rapidly changes, followed by the recovery phase. The S-T segment of the ECG reflects the plateau phase of ventricular muscle cells' action potentials.
What is ECG?The electrical activity of the heart is measured and recorded using a test called an electrocardiogram (ECG or EKG). It aids in the diagnosis of cardiac rhythm issues and heart muscle damage. Electrodes (small, plastic patches) are placed on the skin of the patient's chest, arms, and legs to collect data.
Arrhythmias, heart attacks (myocardial infarctions), and other cardiac issues can be detected using ECGs. It's a non-invasive test that can provide a wealth of information about the heart.
Here you can learn more about S-T segment
https://brainly.com/question/6321902#
#SPJ11
Subject: Science
1. Approximately how far away would the formation of Earth be if you used the scale from your timeline?
2. Which events helped life develop on Earth? ''Explain''.
Because several meteorites have been dated, the Earth's age has increased from 4.55 0.3 billion years in 1956 to 4.55 0.02 billion years. I) The synthesis of nucleotides and amino acids.
How did life on Earth start to appear?In rocks that are 3.7 billion years old, the oldest known life forms, microbes, have left their imprint. The signals were made up of a specific class of carbon molecules produced by living things.
What process created the Earth?Formation. Over a period of 4.5 billion years, whenever the solar system was still in its current configuration, the second planet from the Sun—Earth—was created when gravity drew spinning gas and dust in. Earth has a solid crust, a high degree of crystallinity, and a central core, just like its sibling terrestrial planets.
To know more about nucleotides visit:
https://brainly.com/question/30299889
#SPJ1
kenyatta is participating in a research study examining the effects of a particular hormone. after she is given the hormone, she engages in behaviors that demonstrate trust in strangers, peer bonding, and group cohesion. kenyatta was
The hormone that Kenyatta was given is oxytocin as she encounters behavior that indicates trust in strangers and peer bonding.
What is oxytocin?Oxytocin is often referred to as the "trust hormone" or "bonding hormone" because it plays a role in social behavior and emotional bonding. It is known to promote trust, social bonding, and positive interactions with others.
Oxytocin is released naturally in the body during various social activities such as positive social interactions. In research studies, the administration of exogenous oxytocin has been associated with increased trust, social bonding, and group cohesion, which aligns with the behaviors exhibited by Kenyatta in the study.
Therefore, the hormone that is given to Kenyatta is oxytocin.
Learn more about oxytocin, here:
https://brainly.com/question/1996049
#SPJ6
Your question is incomplete, most probably the full question is this:
Kenyatta is participating in a research study examining the effects of a particular hormone. after she is given the hormone, she engages in behaviors that demonstrate trust in strangers, peer bonding, and group cohesion. Kenyatta was given which hormone?
addictive drugs stimulate a brain region called the nucleus accumbens, which results in intensified feelings of pleasure due to the release of which neurotransmitter?
The addictive drugs stimulate a brain region known as the nucleus accumbens, causing intensified feelings of pleasure due to the release of dopamine (DA), a neurotransmitter. DA release in the nucleus accumbens is a common characteristic of many addictive drugs, making it a critical target for drug development.
The nucleus accumbens (NAcc) is a subcortical structure that is involved in reward-related behaviors. It is considered to be part of the brain's reward system. The reward system is a network of structures that function together to promote adaptive behaviors such as eating and socializing. When a person experiences something rewarding, the reward system is activated, releasing dopamine (DA) and producing feelings of pleasure or euphoria.
A variety of drugs, such as cocaine, amphetamine, heroin, and nicotine, can stimulate the release of dopamine in the nucleus accumbens, leading to feelings of pleasure and euphoria. When someone uses these drugs, they may feel an intense urge to continue using them, which can lead to addiction and other negative outcomes.
Here you can learn more about nucleus accumbens
https://brainly.com/question/29560022#
#SPJ11
the provided structure is an aldehyde substrate derivative that specifically inhibits elastase. which elastase active site residue forms a covalent bond with the aldehyde inhibitor?
The aldehyde substrate derivative that specifically inhibits elastase forms a covalent bond with a serine residue in the active site of elastase.
Aldehydes are a class of organic compounds that have a carbonyl group at the end of their carbon chains, denoted as -CHO. Aldehydes have a polar carbonyl group and a nonpolar hydrocarbon region, making them highly reactive. Aldehydes are classified as primary, secondary, or tertiary based on the degree of substitution of the carbon atom attached to the carbonyl group. Elastase is a serine protease enzyme that breaks down elastin, a major protein component of connective tissue in the body, resulting in the disassembly of elastic fibers. Elastase is secreted by neutrophils, monocytes, macrophages, and fibroblasts, among other cells. It plays a vital role in wound healing and inflammation. The aldehyde inhibitor binds to the active site of elastase and forms a covalent bond with a serine residue. The serine residue is part of the catalytic triad (His, Asp, and Ser) that aids in the breakdown of peptide bonds. The covalent bond formed between the aldehyde inhibitor and the serine residue in the elastase active site is irreversible, resulting in enzyme inhibition. Therefore, the serine residue forms a covalent bond with the aldehyde inhibitor.Learn more about aldehyde: https://brainly.com/question/17101347
#SPJ11
during the menstrual cycle, what triggers ovulation to occur? question 23 options: a gradual decrease in estrogen levels. inhibin b sharply spikes. a surge in progesterone occurs. activin is released.
Ovulation is triggered by a surge in progesterone which occurs during the menstrual cycle.
This surge is caused by the follicle stimulating hormone, which is produced by the pituitary gland. The FSH encourages the growth of follicles in the ovaries, which produce estrogen. As the follicle matures, estrogen levels peak. The peak in estrogen causes the brain to secrete luteinizing hormone, which triggers the follicle to rupture and release an egg (ovulation). Activin, inhibin B, and a gradual decrease in estrogen levels are all part of the process that precedes and follows ovulation. Activin is a hormone secreted by the ovaries, which helps to mature follicles.
Inhibin B is a hormone secreted by the ovaries, which is thought to help control the amount of FSH in the body and in turn the number of follicles that mature. A gradual decrease in estrogen levels occurs as ovulation approaches and during the luteal phase of the menstrual cycle. This decrease in estrogen helps to prepare the body for the next menstrual cycle.
To know more about progesterone click on below link:
https://brainly.com/question/12732603#
#SPJ11
growth hormone, secreted by the gland, stimulates growth of bones and muscle by activating intermediary proteins called
Growth hormone, secreted by the pituitary gland, stimulates the growth of bones and muscle by activating intermediary proteins called growth factors. Growth factors are molecules that bind to receptors on the surface of target cells.
Growth hormone, secreted by the pituitary gland, stimulates the growth of bones and muscle by activating intermediary proteins called STATs (signal transducers and activators of transcription). It has been shown that signaling pathways are crucial to the regulation of growth hormone (GH) in terms of both its secretion and actions.
The signaling pathways used by the GH receptor involve a number of intermediary proteins that interact with the receptor and allow it to carry out its functions. Growth hormone, secreted by the pituitary gland, stimulates the growth of bones and muscle by activating intermediary proteins called STATs (signal transducers and activators of transcription).
These STAT proteins then activate a number of transcription factors that are responsible for the production of various genes that control growth. As a result of this signaling pathway, GH is able to promote growth in both bone and muscle tissues.
Read more about the bones here:
https://brainly.com/question/412179
#SPJ11
what creates the pressure gradient that regulates blood flow in the venous system? select all that apply.
The pressure gradient that regulates blood flow in the venous system is created by a combination of factors, including gravity, the pumping action of the heart, the contraction of muscles in the walls of the veins, and valves within the veins that ensure that blood flows in only one direction.
The pressure gradient that regulates blood flow in the venous system is created by several factors. These factors include skeletal muscle contractions, one-way venous valves, and respiratory movements.
Skeletal muscle contractions exert pressure on the veins and aid in blood flow, especially in the lower extremities. Breathing movements also contribute to the pressure gradient, as inhalation increases thoracic pressure, and exhalation decreases it. These factors work together to maintain blood flow in the venous system.
Learn more about venous system here:
brainly.com/question/14351996
#SPJ11
which of the following is not one of the ways of studying and identifying microorganisms?staining culture animal culture human inoculation
The following is not one of the ways of studying and identifying microorganisms is Animal culture.
Microorganisms can be studied and identified through the following ways:
Staining Culture
Human Inoculation
Animal culture
Staining is a method of dyeing microorganisms to make them visible under a microscope. The process of staining involves the use of chemicals that color certain components of the cell, such as the cell wall, nucleus, or cytoplasm, so that they can be seen more clearly.Culture is a method of growing microorganisms in a lab, usually in a nutrient-rich liquid or solid medium. By observing the growth patterns of the microorganisms, scientists can identify them and determine their properties, such as their size, shape, and metabolic processes.
Human inoculation is the method of studying microorganisms by exposing human subjects to a pathogen under controlled conditions in order to observe how the body responds to the infection. This method is useful in understanding how diseases spread and how they can be treated or prevented.
Animal culture is not a method of studying and identifying microorganisms. However, animal models can be used to study the effects of microorganisms on living organisms, such as the symptoms they cause, the immune response they elicit, and the ways they can be treated.
Here you can learn more about Animal culture
https://brainly.com/question/30273504#
#SPJ11
you have discovered a new kind of cell with a strange new organelle that contains a highly hydrophobic compartment. which will mostly certainly be abundant in this organelle?
The new organelle that you discovered with a highly hydrophobic compartment will most likely contain lipids, such as fatty acids and phospholipids, as they are hydrophobic molecules.
Which molecule will mostly certainly be abundant in this organelle?There are a number of molecules that will most certainly be abundant in an organelle that contains a highly hydrophobic compartment. In the context of biochemistry, the most abundant molecule is usually the one that is most soluble in the organelle's environment.
According to a number of theories, lipids are most likely to be the most abundant molecules in an organelle containing a highly hydrophobic compartment. Lipids are a diverse class of molecules that are primarily defined by their solubility characteristics. Lipids are soluble in organic solvents and insoluble in water, which means they are ideal for forming membranes, which are hydrophobic compartments.
Therefore, lipids will most certainly be abundant in an organelle that contains a highly hydrophobic compartment.
Read more about lipids:
https://brainly.com/question/17352723
#SPJ11
what is the role of the 5' cap on a eukaryotic mrna molecule? multiple select question. it facilitates the exit of mrna from the nucleus. it allows the mrna to bind to a ribosome for translation. it is recognized by rna polymerase to allow the initiation of transcription. it enables the spliceosome to identify the first exon.
The answer to the question is A and B - it facilitates the exit of mRNA from the nucleus and it allows the mRNA to bind to a ribosome for translation.
The role of the 5' cap on a eukaryotic mRNA molecule is to allow the mRNA to bind to a ribosome for translation and it facilitates the exit of mRNA from the nucleus. The 5' cap is a necessary feature of eukaryotic mRNA molecules that aids in their translation. The 5' cap, which is a chemically modified nucleotide added to the 5' end of the mRNA during RNA processing, provides a variety of benefits for the mRNA molecule.
The 5' cap helps to shield the mRNA molecule from RNA-degrading enzymes in the cytoplasm, as well as to promote the ribosome's binding to the mRNA molecule. It also aids in the initiation of protein synthesis by facilitating the formation of a complex between the mRNA, ribosome, and initiator tRNA.
Finally, the 5' cap aids in the process of splicing the mRNA molecule to remove non-coding introns. The 5' cap of eukaryotic mRNA also helps to distinguish between self and non-self RNA. By identifying the 5' cap, host cells may differentiate between their own mRNA and foreign mRNA.
Thus, the 5' cap serves as a molecular "passport" that identifies the mRNA molecule as genuine and necessary for the cell's normal functions.
Therefore, the correct option is A and B.
To know more about translation, refer here:
https://brainly.com/question/28943852#
#SPJ4
which name is given to the phase of the hair growth cycle where the hair falls out?
The phase of the hair growth cycle where the hair falls out is Telogen phase.
The hair growth cycle is the process by which hair grows and falls out, and it involves three stages. The three stages are the anagen, catagen, and telogen phases. The hair growth cycle is a natural process that happens in three stages.
The three stages are:
Anagen phase: The anagen phase is the active growth phase of the hair follicle. It is the period during which the hair grows actively. The anagen phase lasts between 2 and 7 years and is different for each individual.
During the anagen phase, the hair root is firmly implanted in the scalp, and it receives nutrients and oxygen through the blood vessels.
Catagen phase: The catagen phase is the transitional phase of the hair growth cycle. This phase typically lasts between 2 and 3 weeks and is a period of transition from the anagen phase to the telogen phase.
During the catagen phase, the hair stops growing, and the follicle shrinks.
Telogen phase: The telogen phase is the resting phase of the hair growth cycle. During this phase, the hair is fully formed and does not grow.
The telogen phase lasts between 2 and 4 months, and at the end of this phase, the hair falls out.
To know more about Telogen phase, refer here:
https://brainly.com/question/30267882#
#SPJ11
which areas of the cortex undergo substantial structural change in adolescence? (select all that apply)
Some of the areas that undergo substantial structural change during adolescence include:
Prefrontal cortexTemporal cortexParietal cortexFrontal cortexAdolescence is a period characterized by various changes that occur within the human body, including the brain. The brain undergoes various changes, including structural changes in different areas of the cortex.
The prefrontal cortex, for instance, is a critical part of the brain that matures throughout adolescence. During adolescence, the prefrontal cortex undergoes extensive structural changes that help the brain to become more efficient in handling complex cognitive tasks.
The temporal cortex is another critical part of the cortex that undergoes substantial structural changes during adolescence. This area is responsible for handling sound recognition, including speech and music. In adolescents, the temporal cortex undergoes extensive structural changes that help in improving language proficiency.
The parietal cortex is yet another area of the cortex that undergoes substantial structural changes in adolescence. This part of the cortex is responsible for spatial perception, including depth, and plays an essential role in visual and auditory processing.
Finally, the frontal cortex is another critical part of the cortex that undergoes substantial structural changes during adolescence. This area is responsible for controlling executive functions, such as attention, impulse control, decision-making, and emotional regulation.
-------------------------------------
Which areas of the cortex undergo substantial structural change in adolescence? (select all that apply)
Prefrontal cortexTemporal cortexParietal cortexFrontal cortexTo learn more about adolescence refer - https://brainly.com/question/30451097
#SPJ11