Explain, as thoroughly, as possible how both Tonio Kroeger in Mann's Tonio Kroeger and Meursault in Camus's The Stranger are outsiders, each in his own way, and how being this outsider contributes to how each of them sees the world and relates to it.

Answers

Answer 1

Tonio Kroeger in Mann's "Tonio Kroeger" and Meursault in Camus's "The Stranger" are both portrayed as outsiders, each experiencing a unique sense of isolation from society.

Their outsider status significantly influences how they perceive and relate to the world around them.

Tonio Kroeger, a biracial artist, feels disconnected from his bourgeois upbringing and the conservative society he belongs to. His mixed heritage and artistic temperament make him an outsider, as he struggles to reconcile his inner conflicts and find a sense of belonging.

This detachment enables him to observe society with a critical and analytical perspective, as he contemplates themes of art, beauty, and societal norms.

Meursault, on the other hand, is an outsider due to his existentialist and indifferent approach to life. He is unable to experience or express emotions the way others do, causing him to be estranged from societal norms and expectations.

This indifference and detachment lead him to commit a murder, ultimately reinforcing his outsider status. Meursault's lack of emotions allows him to see the world objectively, emphasizing the absurdity and meaninglessness of human existence.

In conclusion, both Tonio Kroeger and Meursault are outsiders in their respective societies, experiencing isolation and disconnection.

Their outsider perspectives contribute to their unique ways of perceiving and relating to the world, as they grapple with themes of identity, existentialism, and societal norms.

To learn more about isolation, refer below:

https://brainly.com/question/13553176

#SPJ11


Related Questions

which character is scrooge's former boss and mentor?

Answers

Scrooge's former boss and mentor is Mr. Fezziwig.

In Charles Dickens' novel "A Christmas Carol," Ebenezer Scrooge's former boss and mentor is indeed Mr. Fezziwig. Scrooge remembers his time working for Fezziwig fondly, as Fezziwig was a kind and generous employer who knew how to enjoy life and valued the happiness of his employees.

Firstly, Fezziwig is depicted as a successful businessman who is not solely driven by profit and personal gain. Unlike Scrooge, who becomes consumed by his pursuit of wealth, Fezziwig recognizes the value of human connection and the well-being of his employees.

He prioritizes their happiness and creates a joyful work environment, promoting a sense of camaraderie and celebration.

Fezziwig's character also exemplifies the importance of generosity and compassion within the American Dream. During a festive Christmas party hosted by Fezziwig, he generously provides food, drink, and entertainment for all his employees and their families.

This gesture showcases his willingness to share his success and ensure that others can experience joy and abundance.

Furthermore, Fezziwig's ability to enjoy life and find happiness in simple pleasures resonates with the ideals of the American Dream. He embraces the spirit of celebration, encouraging dancing, laughter, and merriment.

This emphasizes the notion that success should not be measured solely by material wealth but also by the ability to find fulfillment and happiness in everyday experiences.

This memory serves as a contrast to Scrooge's current miserly and isolated lifestyle, and inspires him to change his ways.

To learn more about contrast, refer below:

https://brainly.com/question/1516829

#SPJ11

Explain the similarities and differences between characteristics and the human condition in othello

Answers

Similarities: Both are explored in Othello, depicting universal aspects of human nature.

Differences: Characteristics refer to individual traits of characters, while the human condition encompasses broader themes and experiences shared by humanity.

Shakespeare wrote Othello. Othello, a Venetian army general of Moorish descent, is undone by jealousy and manipulation. The play addresses love, envy, betrayal, racism, and the destructive force of unchecked emotions.

Othello's terrible flaws—vulnerability to deception and self-awareness—cause his downfall. The drama explores human nature, showing how envy destroys and emotions are fragile.

Learn more about othello, here:

https://brainly.com/question/334732

#SPJ1

suggests that no one can have a completely objective view of their surroundings as they are part of them


a.
new historical lens


b.
contextual lens


c.
biographical lens


d.
all of the above

Answers

All suggests that no one can have a completely objective view of their surroundings as they are part of them. The Option D.

What are the different lenses which suggest so?

When it comes to perceiving and understanding our surroundings, various lenses come into play. A new historical lens enables us to examine our surroundings through the perspective of historical context recognizing that our present experiences are shaped by past events.

A contextual lens considers the immediate environment and circumstances that influence our perception. The biographical lens acknowledges the unique experiences, beliefs and biases that individuals bring to their understanding of the world.

Read more about objective view

brainly.com/question/30338495

#SPJ1

by 1850, the south's railroad networks accounted for approximately 50 percent of the lines in the nation. T or F

Answers

The correct answer is false because the south's railroad networks did not account for approximately 50 percent of the lines in the nation.

How much did south's railroad networks account for?

By 1850, the South's railroad networks accounted for approximately only 9% of the total railroad mileage in the United States, with the majority of the lines located in the North and the Midwest. The South's railroad development lagged behind that of the North due to factors such as limited capital, lack of government support, and the reliance on slave labor, which made it more difficult to attract free labor to work on the railroads. The expansion of railroads was a key factor in the economic development of the United States in the 19th century, but the South's relative lack of investment in this infrastructure contributed to its economic struggles in the years leading up to the Civil War.

To learn more about the south's railroad networks, visit

brainly.com/question/17309167

#SPJ11

Diagram the sentence, grass grows

Answers

Answer:

The sentence "grass grows" is a simple sentence consisting of a subject and a verb. The subject of the sentence is "grass," and the verb is "grows." The sentence is written in the present tense and communicates a straightforward fact. When diagrammed, "grass" would be written on the left-hand side of a vertical line, and "grows" would be written on the right-hand side of the line, with an arrow connecting the two words to show that "grass" is the subject and "grows" is the verb. The sentence diagram would consist of only these two elements, emphasizing the simplicity of the sentence.

Explanation:

Can I have brainliest pretty pretty please

Can someone answer these questions? The book is “The night” btw

Answers

The literary devices employed in this excerpt from the book are parallelism and repetition. The tones of indifference and seriousness are explored in the sentences.

What devices are used?

In these quotes drawn from the book, The Night, we can see the repetition for emphasis used by the speaker. There are also examples of parallelism where words are coined in a similar form to make the ideas clearer to the reader.

At first, the speaker is indifferent but when he experienced what others were facing, he learned to become concerned.

Learn more about literary devices here:

https://brainly.com/question/2183813

#SPJ1

how was jack liberated from the shame of self consciousness

Answers

Jack liberated himself from shame by practicing self-acceptance, mindfulness, and surrounding himself with a supportive community that celebrated his uniqueness.

Jack's liberation from the shame of self-consciousness was a gradual and transformative process that involved self-reflection, self-acceptance, and personal growth.

Initially, Jack struggled with feelings of insecurity and shame, constantly worried about how others perceived him and anxious about his every action.

However, he embarked on a journey of self-discovery and self-compassion to overcome these limiting beliefs.

Jack started by practicing self-awareness, observing his thoughts and emotions without judgment.

He learned to recognize the patterns of negative self-talk and replaced them with positive affirmations.

Jack also cultivated mindfulness, living in the present moment and embracing his true self, rather than dwelling on past mistakes or future uncertainties.

Furthermore, Jack engaged in activities that nurtured his self-esteem and self-worth. He pursued hobbies and passions that brought him joy and a sense of accomplishment.

Surrounding himself with supportive and uplifting individuals, he found a community that celebrated his uniqueness and encouraged his personal growth.

Through this journey, Jack gradually discovered his own inherent worth, realizing that his value as a person extended beyond external validation.

He learned to embrace imperfections as opportunities for growth and to view vulnerability as a strength rather than a weakness.

Jack's liberation from the shame of self-consciousness came from within, as he cultivated self-compassion, self-acceptance, and a deep understanding of his own intrinsic value.

For more such questions on Jack liberated

https://brainly.com/question/29703007

#SPJ11

avoiding plagiarism, citing sources, and maintaining academic integrity:

Answers

The easiest strategy to prevent plagiarism is to always cite your sources, both in your paper's main body and in a list of the sources you utilized in the conclusion.

Giving acknowledgment to the original author and allowing the reader to check the concepts on which you have built your own argument are two benefits of citing.

The principles of honesty, fairness, and respect are all part of academic integrity. Plagiarism is the act of using someone else's words or ideas without properly attributing them to their source by citing and referencing that source.

To avoid accusations of plagiarism, the original information must be cited and stated where it was found (see the "Source:" section below). "There are various techniques to avoid plagiarism, such as making strong research habits, practicing time management skills, and taking ownership of your own education.

To know more about plagiarism refer here:

https://brainly.com/question/30180097

#SPJ4

“Doublethink means the power of holding two contradictory beliefs in one’s mind simultaneously, and accepting both of them.” “Until they become conscious they will never rebel, and until after they have rebelled they cannot become conscious.” how do these quotes show a theme of self reliance in the book 1984

Answers

The excerpts from George Orwell's novel 1984 stress the significance of individual understanding and resistance to oppressive regimes as a means of maintaining independence.

In authoritarian cultures, the idea of "doublethink" is a metaphor for the internal conflict that people go through since it includes having opposing views without challenging them.

This demonstrates how much the Party is able to influence and control its supporters' thoughts.

However, rather than passively accepting imposed beliefs, people might develop a sense of independence by identifying the contradictions in their beliefs and actively seeking their own truths.

Learn more about Orwell here:

https://brainly.com/question/19204387

#SPJ1

Which excerpt best summarizes a central idea in I Was Their American Dream?

Sometimes a person’s identity cannot be formed.
Malaka’s family was different from families on TV.
Malaka’s parents are from different countries.
Identity is influenced by many factors.

THE ANSWER IS D!!!

Answers

Answer & Explanation:

The excerpt that best summarizes a central idea in "I Was Their American Dream" is "Identity is influenced by many factors." The book explores the author Malaka Gharib's experiences growing up as a first-generation Filipino Egyptian American. Throughout the book, Gharib reflects on the various factors that influenced her identity, including her mixed heritage, her family's immigration stories, her struggles with racism and self-esteem, and her experiences navigating different cultural expectations. The book highlights the complexity and fluidity of identity, and the ways in which it can be shaped by a wide range of factors.

Answer: Identity is influenced by many factors so the answer is D

Explanation:

The absolute threshold for hearing is arbitrarily defined as zeroA) decibels.B) amps.C) phonemes.D) hertz.

Answers

The absolute threshold for hearing is arbitrarily defined as zero decibels (option A).

The absolute threshold for hearing refers to the minimum sound intensity or pressure level required for a sound to be detected by the human ear. This threshold is usually defined as a sound intensity of 0 decibels (dB) at a frequency of 1000 hertz (Hz), which is the frequency at which the human ear is most sensitive. Therefore, Option A is the correct answer.

Option B (amps) is not related to sound or hearing, but rather refers to the unit of electrical current.

Option C (phonemes) refers to the smallest units of sound in language.

Option D (hertz) refers to the frequency of a sound wave, which is important for determining pitch but not the threshold for hearing.

To learn more about Hearing, visit:

https://brainly.com/question/28496438

#SPJ11

what is one problem associated with the availability heuristic?

Answers

The availability heuristic is a mental shortcut that relies on immediate examples that come to mind when making judgments or decisions.

One problem associated with the availability heuristic is that it can lead to biases and errors, as the information that comes to mind may not be representative of the overall population or situation. This can result in overestimating the likelihood of rare events or underestimating the likelihood of more common events, leading to faulty decision-making.

The availability heuristic is a mental shortcut in which people make judgments and decisions based on the ease with which examples come to mind. This can lead to overestimating the likelihood of events that are more easily remembered, even if they are not actually more likely to occur.

For example, if someone hears news reports of several shark attacks in a short period of time, they may become afraid to go swimming in the ocean, even though the risk of a shark attack is actually very low. Similarly, people may be more likely to invest in a company that is in the news frequently, even if there is little evidence to suggest it is a good investment.

Overall, the availability heuristic can lead to errors in judgment and decision making by overemphasizing the salience of certain information while ignoring other, potentially more important, factors.

To learn more about availability heuristic, visit:

https://brainly.com/question/30764764

#SPJ11

Ophelia has written this thesis statement for her informative speech: while both northerners and southerners believed they fought against tyranny and oppression, northerners focused on the oppression of slaves while southerners defended their own right to self-government. Which outline for the rest of her speech is probably the most effective?a. 1. Industrial causes of war in the northa. [supporting details]b. [specific examples]2. Agricultural causes of war in the southa. [supporting details]b. [specific examples]conclusion: restate thesisb. 1. Though causes on both sides were similar, the north’s cause was more justa. [supporting arguments]b. [specific examples]2. Abolishing slavery was worth dying fora. [supporting arguments]b. [specific examples]3. South had no right to self-governmenta. [supporting arguments]

Answers

A talk that is informative the argument put out by thesis statement this choice is as follows while both Northerners and Southerners believed they were fighting against oppression and tyranny.

Northerners concentrated on the exploitation of slaves while Southerners defended their own right to self-government. It is a speech with three characteristics:

(1) it seeks to inform;

(2) it has educational goals;

(3) it seeks to expose a theme.

An instructive speech provides information so that the audience will be able to understand a certain subject, not arguments or the speaker's beliefs. The thesis statement in this instance needs to be clear and present the core idea of the subject. Due of this, option thesis statement is a fantastic selection for an enlightening.

To know more about Thesis statement visit:

https://brainly.com/question/20631374

#SPJ4

please help plesseee due tmr

Answers

The answer is Mrs. Cook may consider using the left over money for rims and nets.

The Black-Scholes-Merton model assumes that the volatility does not change throughout the option's life. F. T F

Answers

The Black-Scholes-Merton model assumes that the volatility changes throughout the option's life, so the answer is False.

What is Black-Scholes-Merton model?

The Black-Scholes-Merton model is a mathematical model used to price options contracts, taking into account factors such as the current stock price, the option's strike price, the time until expiration, interest rates, and expected volatility.

One of the assumptions of the model is that the volatility of the underlying stock remains constant over the life of the option. However, this assumption is often unrealistic, as volatility can change due to various market factors such as economic news, corporate announcements, and changes in investor sentiment.

To account for this, more advanced models have been developed that incorporate time-varying volatility, such as the GARCH (Generalized Autoregressive Conditional Heteroscedasticity) model.

Overall, while the Black-Scholes-Merton model is a widely used and important tool in options pricing, it is important to recognize its limitations and use it in conjunction with other models and market analysis techniques to make informed investment decisions.

To learn more about Black-Scholes-Merton model, visit

brainly.com/question/31859660

#SPJ11

Mr Mendoza the new principal announced the awards

Answers

Some of the teachers had already left when the principal called the meeting to order.

Both the principal and the teacher arrived in the preceding phrase. The right phrase is therefore, "The Principal and teacher are coming." 'The' is the right response. 'The' is a definite article that is used to specify nouns. Since there is only one principal at a school, the noun "principal" in the context of a school is a specific one and needs the article "the" alongside it.

Principal, you are the one who leads us. You display motherly affection and impart fatherly assurance. You are a terrific leader because of your never-ending concern, direction, and assistance. We consider ourselves quite fortunate to have a principle like you, and we cordially extend our welcome to you, sir or madam.

To know more about principal refer here:

https://brainly.com/question/32169195

#SPJ4

when proofreading a sentence the notation is used to indicate

Answers

When proofreading a sentence, the notation is used to indicate any errors or suggested changes in the text.

This may include grammar, punctuation, spelling, or formatting corrections to improve the overall quality and readability of the sentence.

Grammar errors: This could include incorrect verb tenses, subject-verb agreement issues, or problems with sentence structure.

Punctuation errors: This might include missing commas, semicolons, or periods, or incorrect usage of apostrophes, quotation marks, or other punctuation marks.

Spelling errors: This could involve correcting misspelled words or words that are spelled correctly but used in the wrong context.

Formatting errors: This could include issues with margins, font size, line spacing, or other formatting requirements for the specific document.

To learn more about proofreading, refer below:

https://brainly.com/question/30673999

#SPJ11

Stephen decides to confess his sins:
a. By talking to Father Arnell in a private confession
c. To please his mother
b. By returning to the same streets where he found the prostitute and finding a secluded church
d. Because he needs to confess his sins before he can become a priest

Answers

In his story, Stephen decides to confess his sins by talking to Father Arnell in a private confession. The Option A is correct.

How does Stephen decide to confess his sins?

Stephen Dedalus decides to confess his sins by talking to Father Arnell in a private confession. This decision is motivated by Stephen's desire to repent for his sins and purify himself in preparation for his vocation as a writer.

Stephen is tormented by guilt over bad experiences and betrayal of his religious faith but seeks absolution and guidance of a priest to reconcile with his conscience. Through his confession, he gained sense of spiritual relief and self-awareness which paved the way for his personal growth and artistic development.

Read more about Portrait of the Artist as a Young Man

brainly.com/question/18188383

#SPJ1

How do I cancel? You billed my credit card and do not have ANY contact information

Answers

Starting with the seller, submit your request. However, get in touch with your card provider if the merchant keeps using your credit card.

Beginning the day the card issuer gives you the statement containing the charges, you have 60 days to contest the charge.

For good reason, credit experts advise against canceling credit cards even if you aren't using them. According to Beverly Harzog, a consumer finance analyst for U.S. News & World Report and a credit card specialist, canceling a credit card could lower rather than raise your score.

Your credit score will decline. Additionally, if you continue to reject the debt collection companies' collection efforts, they will keep reporting your account to the credit bureaus as being past due. Eventually, the account might be turned over to a collection agency, which might lower your rating even further.

To know more about credit card refer here:

https://brainly.com/question/27312834

#SPJ4

Julio is the captain of his school’s debate club. The club will be competing with a rival school in a few weeks, and Julio is planning to give the members a speech motivating them to prepare more effectively for this competition than they did for the last one. Julio’s sister read just the introduction and said she didn’t think the speech would be very motivational. This is the introduction she read: Okay, guys. As you know, we didn’t do very well when we went up against Littleton last month. We need to do better when we meet the Crossville team next month, or we won’t make it to the district tournament. So, let’s analyze Crossville’s strategies. Then we’ll know what we’re up against. Julio’s sister suggested he try a different approach. What approach should Julio take? A. Julio should use a more formal style so that the team members will realize that he is serious about this problem. B. Julio should take a more positive approach to the subject, focusing on winning rather than on losing and analyzing their own team’s winning performances to identify strategies that led to success. C. Rather than analyzing just one team’s work, Julio should collect videos of various debate teams in action and, in his speech, compare and contrast them extensively, so that his team will understand a wide variety of debating strategies. D. Julio should not rely on a speech to get across this important information; instead, he should create a manual he can distribute to the debate club members, in which he outlines the rules of debate and the strategies that are widely acknowledged to be successful. please hurry!!!!!

Answers

Answer:The answer is B

Explanation:

I promise, i juts got done taking the test :)

Julio should take a more positive approach to the subject, focusing on winning rather than on losing and analyzing their own team’s winning performances to identify strategies that led to success.

Julio should focus on the team's potential for success and highlight their past winning performances to identify effective strategies.

By emphasizing the goal of winning and the team's ability to achieve it, Julio can motivate his club members to prepare more effectively for the upcoming competition.

Suggesting a more formal style, may not necessarily address the motivational aspect. While a serious tone can convey the importance of the situation, it may not inspire the team members to put in extra effort.

Learn more about formal style here:

https://brainly.com/question/30106876

#SPJ1

1. He excelled at most sports, but for some reason basketball was his Achilles' heel.


- Positive tone, analogy


- Positive tone, allusion


-Negative tone, analogy


- Negative tone, allusion


2. I should start calling her Pollyanna. She found a way to make me feel better about what happened, finding the good that came out of it.


-Positive tone, analogy


-Positive tone, allusion


- Negative tone, analogy


- Negative tone, allusion









SOMEONE PLEASE HELP WORTH 16 POINTS!!!!!!!

Answers

Conclusion: Positive tone, analogy: In this analogy, the person's success in other sports is compared to a well-rounded athlete, who has a strong foundation in many areas of athleticism.

1. This analogy suggests that despite his struggles with basketball, the person is still a talented and well-rounded athlete, with many strengths and abilities.

2- Positive tone, allusion:

In this analogy, the person's success in other sports is compared to a formidable competitor, who is strong and skilled in many areas. This analogy suggests that despite his struggles with basketball, the person is still a strong and capable athlete, with a lot to offer in other areas.

3- Negative tone, analogy:

In this analogy, the person's struggles with basketball are compared to a weak link in a chain, which can break under pressure and prevent the entire chain from functioning properly. This analogy suggests that the person's struggles with basketball are holding him back from reaching his full potential as an athlete, and preventing him from achieving success in other areas.

4- Negative tone, allusion:

In this analogy, the person's struggles with basketball are compared to a brick wall, which can block a person's path and prevent them from moving forward. This analogy suggests that the person's struggles with basketball are preventing him from reaching new heights in the sport and from achieving success in other areas.  

Learn more about Positive tone visit: brainly.com/question/30123122

#SPJ4

Correct Question:

1. He excelled at most sports, but for some reason basketball was his Achilles' heel.

1- Positive tone, analogy

2- Positive tone, allusion

3-Negative tone, analogy

4- Negative tone, allusion.

Which phrase correctly uses a verbal to complete the sentence?
An advantage to being the new kid is that everyone wants __________ you.
to being met
meet
to meet
to meeting

Answers

╭┄┈┄────────❥

Answer:

↣ An advantage to being the new kid is that everyone wants to meet you.

Explanation:

To be brief, it is grammatically correct to use the verbal phrase 'to meet' in order to precisely complete the sentence given above.

. . • ☆ . ° . • °: . * ₊ ° . ☆

I hope this helps!

peachtea ^-^

╰┄┈┄──❥

Answer:

C

Explanation:

The correct word is:

An advantage to being the new kid is that everyone wants to meet you.

All the other choices are either grammatically wrong or don't make sense when used in the sentence.

∴ C: to meet

Write a Short story about technology: to face the future challenges such as education

Answers

Sophie was a bright young student with a passion for technology. She had always been fascinated by the possibilities that it offered for solving problems and making the world a better place. As she progressed through her education, she realized that there were many challenges ahead that would require innovative solutions.

One day, Sophie stumbled upon a new technology that had the potential to revolutionize education. It was a virtual reality platform that allowed students to experience simulations of real-world scenarios, enhancing their learning experience and preparing them for the challenges ahead.

Sophie was determined to make this technology a reality in her school. She presented her idea to the faculty and worked tirelessly to secure funding and support for the project. Finally, after months of hard work, the virtual reality platform was implemented in the curriculum.

The results were astounding. Students were engaged and excited about learning, and their test scores improved dramatically. Sophie had proven that technology was the key to facing future challenges in education.

From that day forward, Sophie dedicated her life to harnessing the power of technology to make a positive impact on the world. She knew that with innovation and determination, anything was possible.

For more question on determination

https://brainly.com/question/640820

#SPJ8

What is the sentence pattern of:

There is a good reason to be thankful

Answers

The sentence pattern of "There is a good reason to be thankful" is a simple declarative sentence that expresses a positive idea or opinion.

It uses the present continuous tense to indicate that there is an ongoing or continuing reason to be thankful, and the use of "a" before "good reason" suggests that there may be more than one reason to be thankful. The word "to" introduces a preposition, "to be thankful," which indicates the reason or reasons why one should be thankful. Finally, "is" is a third-person singular present tense verb that indicates that the reason or reasons exist or are true.

Overall, the sentence pattern of "There is a good reason to be thankful" is a simple declarative sentence that expresses a positive idea or opinion. It uses the present continuous tense to indicate that there is an ongoing or continuing reason to be thankful, and the use of "a" before "good reason" suggests that there may be more than one reason to be thankful.  

Learn more about sentence visit: brainly.com/question/939685

#SPJ4

Look back over the opening sequence before Guy Montag meets Clarisse McClellan. What two adjectives would you use to describe this man? What textual evidence leads you to this conclusion?

Answers

Two adjectives to describe Guy Montag before meeting Clarisse McClellan are conformist and indifferent. The textual evidence supporting this conclusion can be found in the description of his daily routine and behavior in the opening sequence.

Firstly, Montag's conformity is evident in his adherence to societal norms and expectations. The text portrays him as someone who mindlessly follows the routines of his job as a fireman, burning books without questioning the purpose or implications of his actions. This is seen in lines such as "It was a pleasure to burn" and "He wore his happiness like a mask."

Secondly, Montag's indifference is apparent in his lack of introspection and emotional detachment. He goes through his daily routine without considering the significance or consequences of his actions. The text states, "Montag felt his body divide itself into a hotness and a coldness, a softness and a hardness," indicating a disconnection from his own emotions.

Overall, Montag is portrayed as a conformist who unquestioningly follows societal norms and an indifferent individual who lacks introspection and emotional engagement.

Learn more about Guy Montag

https://brainly.com/question/31912507

#SPJ4

Which of the following is the best synopsis of the piece?
*
Farrell argues that the crises boys face are a major problem. He provides statistical evidence and emotional appeal to show how serious the problem is.
Farrell suggests that society should pass laws to help boys. He uses emotional appeals and ethos to support the solutions he proposes.
Farrell downplays the negative consequences of the mental health issues boys face. He provides numerous examples and anecdotes to connect with the reader’s sympathy.
Farrell claims that feminism is a huge problem. He quotes experts and provides statistical evidence to prove that feminism harms boys.

Answers

Based on the given options, the best synopsis of the piece would be:

"Farrell argues that the crises boys face are a major problem. He provides statistical evidence and emotional appeal to show how serious the problem is."

How to explain the information

The best synopsis of the piece is that Farrell argues the crises boys face are a major problem. This means that the author believes there are significant challenges and difficulties specifically affecting boys.

To support this argument, Farrell provides statistical evidence, which likely includes data and facts that demonstrate the extent of the problem. Additionally, the author employs emotional appeal, likely using personal stories or narratives that evoke an emotional response from the reader, to further emphasize the seriousness of the issue.

Learn more about synopsis on

https://brainly.com/question/30399144

#SPJ1

Four friends decide - go on picnic – reach canal bank – do not know how to swim – enter water – ignore warning - go in deep water – start drowning – fisher men rescue – rewarded. . ​

Answers

Four friends, who did not know how to swim, decided to go on a picnic near a canal bank. Despite seeing warning signs about the dangers of swimming, they entered the water anyway. Unfortunately, they soon found themselves in deep water and began to drown. Luckily, some nearby fishermen noticed their distress and swiftly came to their rescue. The fishermen successfully saved the friends from drowning.

Grateful for their rescue, the friends decided to reward the fishermen for their heroic actions. They expressed their gratitude and appreciation for saving their lives. The specific details of the reward were not mentioned, but it could have been in the form of a monetary gift, a heartfelt thank-you, or any other gesture of appreciation.

It is important to remember that water bodies can be dangerous, especially for those who do not know how to swim. Ignoring warning signs and entering deep water without proper swimming skills can lead to life-threatening situations. It is crucial to prioritize safety and take appropriate precautions when near bodies of water to prevent accidents and potential tragedies.

Learn more about four friends picnic

https://brainly.com/question/28011859

#SPJ4

I know it's easy but can someone PLEASE have all 4 of these done in like 2 3 hours PLEASE PLEASE PLEASE HELP???????????

Answers

The words that can be used to complete the hyperbole are given below

HippoIt can write a novelMy ribs ached from too much laughing

What is the effect of line 2?

The effect which line 2 creates is that it shows that Moose is lost and this has some profound significance because he is in the forest and he does not know his way around and "bumps around" the forest.

The poem is an example of low comedy because it makes use of a lot of slapstick and exaggerated behavior by Moose.

The effect of hyperbole in line 18 is to show the mess which Moose is making as he asks where he belongs.

Read more about hyperbole here:

https://brainly.com/question/2351925

#SPJ1

hermann ebbinghaus' learning experiments using nonsense syllables show that:

Answers

Hermann Ebbinghaus' learning experiments using nonsense syllables showed that the rate of forgetting new information is greatest just after learning and gradually declines over time.

Ebbinghaus used nonsense syllables to eliminate any pre-existing associations with the stimuli, which allowed him to study the process of learning itself.

In his experiments, he memorized lists of nonsense syllables and then measured how much he could recall after varying lengths of time. He found that the more time that passed, the more the information was forgotten.

He also discovered that the amount of time it took to relearn the information decreased each time he practiced. Ebbinghaus' research laid the foundation for the study of memory and forgetting.

Learn more about :  

Hermann Ebbinghaus' : brainly.com/question/30369133

#SPJ4

find the obverse of "some arabs are christians."

Answers

The obverse of "some Arabs are Christians" would be "some Arabs are not Christians."

The obverse is obtained by negating the predicate of the original proposition and replacing it with its complementary term.

In this case, the original statement affirms that there exists a non-empty subset of Arabs who are Christians.

The obverse negates this by stating that there is also a non-empty subset of Arabs who are not Christians.

It is important to note that the obverse is not equivalent to the original statement, as they could both be false or both be true. However, if the original statement is true, then the obverse must also be true.

Learn more about :  

obverse : brainly.com/question/31977065

#SPJ4

Other Questions
write a function called makechange() that takes in a value in cents, represented as an int and then calculates the number of quarters, dimes, nickels, & pennies needed for change a trade of securities between a bank and an insurance company without using the services of a broker-dealer would take place on the A. second market B. third marketC. fourth marketD/ first market a strong organizational culture helps people identify a businesss _____. observe the reflected ray for other angles of incidence. is the reflected ray completely polarized? partially polarized? Hi I need help with this question(4) Let f : R2 + R2 be defined by f(x, y) = (2 - x + 3y + y2, 3x 2y xy) - 2 Use directly the definition of the derivative to show that f is differentiable at the origin and compute f'(0,0). Hint: If the derivative exists, it is in L(R2, R2), so it can be represented by a 2x2 matrix. What if a person SHOULD have inherited the Normal Coding DNA fromtheir parents leading to the "trait" described by the amino acid sequence inthe protein BUT... something happened leading to the mutation shown inthe Mutant Coding DNA [Mutations highlighted Green] 1) Transcribe andtranslate the Normal DNA and tell me which trait they SHOULD haveinherited 2) Transcribe and translate the Mutant DNA and tell me whichtrait they ACTUALLY inherited. 3) Would this be an example of a "silentmutation"? Explain why or why not.You should work this out on scratch paper. Be VERY careful when copying downthe DNA (and/or writing out your mRNA sequences) to make sure you don't changethe sequence. Your answer should be a string of letters representing the aminoacids in the protein (do NOT type the mRNA sequence). The amino acid sequencewill spell real WORDS if done correctly.Normal Coding DNA AATATGCCCAGGGAAACGACATATTTTGCGTGCGAATGAMutant Coding DNA AATATGAGTATACTCCTGTATTTTGCGTGCGAATGA which statements best describe manufacturing in north carolina? check all that apply. outsourcing has resulted in a loss of jobs in the state. foreign competition has led to declining sales of products made in north carolina. the furniture industry is no longer important to north carolina. a number of textile mills were forced to shut down across the state. many furniture factories have closed in north carolina in recent years. the textile industry is in decline, while the apparel industry is on the rise. The boiling point of an liquid is 383CWhat is the melting point of the liquid?Pick the correct answer. 70 383 390 400 483 They play football (interogative) If the fatty acid 14:1^7 is completely catabolized to CO2 and H20, what would be the net yield of ATP? A) 90.5 ATP B) 92 ATP C) 92.5 ATP D) 94 ATP E) 94.5 ATP belgium, netherlands, and luxembourg make up the benelux countries(TRUE/FALSE) suppose that y is a linear function of x. increasing x by 3.7 units decreases y by 0.4 units. what is the slope? radiometric dating estimates the start of the phanerozoic at __. a recent study implemented a year-long intervention with the goal of reducing the harmful effects of violent television content on children's behavior by implementing 31 brief lessons with primary-grade children. what was the result of this research? Do you believe that J. P. Morgan was right to assume such a large role in directing the U. S. Economy? Why or why not? A company is planning to spend $100.000 now for possible replacement of the heating and cooling systems in three of its larger manufacturing plants. If the replacement won't be needed for 4 years, how much will the company have in the account, if it earns interest at a rate of 8% per year? A. $133,022,01 B. $136,048,89 C. $135,048,89 D. $146,048,98 from 1950 until 2000, the labor force participation rate has A) Identity ONE ideology that informed the author's point of view in the passage. b) Explain ONE way in which the actions of the Chilean military as described in the passage reflect the global political context of the late twentieth century. c) Identity ONE state in Latin America or Africa, other than Chile, in which global geopolitical circumstances led to political instability in the second half ofthe twentieth century Help please its due today! The following function is cumulative distribution function, 0 F(t) = 0.25 5 < x < 35 - 0.85 35 < x < 55 1 55 < x Determine the requested probabilities. Round your answers to two decimal places (e.g. 98.76). P(Xs 55) = 1 P(X < 45) = i Pl 45 sXs65) = i P(X< 0) = i